ID: 1051462029

View in Genome Browser
Species Human (GRCh38)
Location 9:17330049-17330071
Sequence TGACTTCTGTTGTTAAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051462027_1051462029 -2 Left 1051462027 9:17330028-17330050 CCTACAAGATTAGTTTTCCTGTG 0: 1
1: 0
2: 1
3: 17
4: 176
Right 1051462029 9:17330049-17330071 TGACTTCTGTTGTTAAAATGTGG No data
1051462026_1051462029 19 Left 1051462026 9:17330007-17330029 CCAGTTTTCATGAACAGGTTTCC 0: 1
1: 0
2: 0
3: 17
4: 140
Right 1051462029 9:17330049-17330071 TGACTTCTGTTGTTAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051462029 Original CRISPR TGACTTCTGTTGTTAAAATG TGG Intronic
No off target data available for this crispr