ID: 1051464941

View in Genome Browser
Species Human (GRCh38)
Location 9:17367190-17367212
Sequence AGGGAGAATGCAGTGACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 644
Summary {0: 4, 1: 13, 2: 53, 3: 129, 4: 445}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051464935_1051464941 13 Left 1051464935 9:17367154-17367176 CCATGTGACATGGAGAGAGAATT 0: 1
1: 0
2: 11
3: 41
4: 273
Right 1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG 0: 4
1: 13
2: 53
3: 129
4: 445
1051464933_1051464941 24 Left 1051464933 9:17367143-17367165 CCTGGCAGTGGCCATGTGACATG 0: 1
1: 0
2: 9
3: 66
4: 273
Right 1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG 0: 4
1: 13
2: 53
3: 129
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051464941 Original CRISPR AGGGAGAATGCAGTGACTGT TGG Intronic
900707699 1:4090683-4090705 AGGGAGAAGGCAGTGTCAGGAGG + Intergenic
903302466 1:22389337-22389359 GGGGACAAAGCAGTGTCTGTGGG + Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907934165 1:59027391-59027413 TGGGAGAATCCAGTGACTCACGG - Intergenic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
908478865 1:64517418-64517440 AAGGAGAATTAAGTGAGTGTGGG + Intronic
909541713 1:76799100-76799122 ATGGAGAAAGTAGTGACAGTTGG + Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
910188475 1:84571219-84571241 AGGCAGAATACAGAAACTGTTGG + Intronic
910440112 1:87243044-87243066 AGGGAGAAAGCAGTGCCTAACGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910851948 1:91657261-91657283 AGGGAGAATGTAGTGGGTGTTGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911593167 1:99770847-99770869 GGGGAGAATTCAGTGGCGGTAGG + Intergenic
911668979 1:100587100-100587122 AGGGAAGAAGCAGAGACTGTTGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
914425724 1:147573874-147573896 TGGCATAATGCAGTGACAGTGGG - Intronic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915831475 1:159134856-159134878 AGGGAGAATGCCGTGCATGAAGG - Intronic
917201492 1:172521121-172521143 AGGGATAATGCAAAGTCTGTGGG + Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918683788 1:187389522-187389544 AAGGAGAATGCAGTGGCTTTGGG + Intergenic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
920118838 1:203640268-203640290 AGGGAGGATGCAGTGAGAGCAGG - Intronic
920161005 1:203997567-203997589 TGGGAGAAAGCAGTGGCTATGGG - Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920914919 1:210251792-210251814 CCGGAGAATGCAGTGGGTGTGGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922998413 1:229985172-229985194 AGGGAGAAGGCAGAGTCCGTGGG + Intergenic
923430862 1:233919203-233919225 AGGGAGAATGGTGTGAATTTTGG + Intronic
924250901 1:242132173-242132195 AAAGAGAATGCAGTGATTGCGGG + Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063056348 10:2509088-2509110 AGGGAGAGTGGAGTGAATCTTGG + Intergenic
1063469021 10:6269553-6269575 GGGGAAAATGCAGTGAATATAGG + Intergenic
1064633354 10:17339685-17339707 AGTGAGAATGCACTAAATGTTGG - Intronic
1064950272 10:20840995-20841017 GGGGAAAATGAAGTGTCTGTAGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066194728 10:33088175-33088197 AGGTAGAATAGAGTGACTCTAGG - Intergenic
1066203059 10:33160348-33160370 AGTGAGAATGTAGGGAATGTGGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1066780714 10:38942550-38942572 TGGGAGAAAGCAGTGGCGGTGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067229162 10:44395003-44395025 AGGAGGGAGGCAGTGACTGTTGG - Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068828899 10:61470228-61470250 AGGAAGAATTCAGTGCCAGTTGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071998317 10:91168585-91168607 AGGGAGAAGGCAATGACTTGAGG + Intronic
1072725865 10:97813529-97813551 AAAGAGAAGGCAGTGACTTTAGG + Intergenic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1073057078 10:100709844-100709866 CTGGAGAATGCAGTGCCTGAGGG - Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075160456 10:120020246-120020268 TGGGAGAATTCAGTAAATGTTGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075974967 10:126686913-126686935 AGGCAGAATGCAGGCAATGTTGG + Intergenic
1076709126 10:132321491-132321513 AGGGTGAATGAAGTGGCTCTGGG - Intronic
1078351836 11:10601339-10601361 AGAGGGAATGCAGTGGATGTAGG + Intronic
1078451657 11:11444910-11444932 CCAGAGACTGCAGTGACTGTGGG + Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079418233 11:20260711-20260733 AGGCAAAATGCACTGACTATGGG + Intergenic
1079443280 11:20536259-20536281 AGCCAGAGTGCCGTGACTGTGGG - Intergenic
1080096879 11:28418775-28418797 AGGCAAAGTGCAGTGAATGTGGG + Intergenic
1080192605 11:29570029-29570051 AGGGAGAATCCTGTCAGTGTGGG - Intergenic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1081522161 11:43892885-43892907 AGGGAGAAAACATTGACTGAGGG + Intronic
1081868450 11:46372344-46372366 AGGGAGAGGGGTGTGACTGTGGG - Intronic
1081915687 11:46728783-46728805 AGGGTGAATGTAGTCACTGAAGG - Exonic
1081952944 11:47061392-47061414 AGGGAAAATGCAGACACTTTAGG + Intronic
1082654304 11:55834477-55834499 AGGGAGAAGGGGGTGATTGTCGG - Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1084141526 11:67233974-67233996 AGGGAGAATTCAAACACTGTCGG - Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085031249 11:73272160-73272182 AGGGTGAATGAAGTGACTTGCGG + Intronic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085826518 11:79853427-79853449 AGGGACAATGATGTGTCTGTGGG - Intergenic
1085937734 11:81170144-81170166 AGGGAGAATTCAGAGAATGGAGG - Intergenic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1087567207 11:99876415-99876437 AGGGAGAATGCAGTGTAGGAAGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1088946990 11:114524293-114524315 AAGGAGAAGGCAGTGAGTATTGG + Intronic
1089998544 11:122932007-122932029 ATGGAGTATGCAGCGACTGCGGG + Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090476017 11:127021037-127021059 AGGGAGAAATCAGTGGCTGAAGG + Intergenic
1092403710 12:8199990-8200012 ACCAAAAATGCAGTGACTGTTGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092878941 12:12872863-12872885 AGGGTGACTGCTGGGACTGTGGG + Intergenic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094641818 12:32283125-32283147 AGGGAAGATGGACTGACTGTAGG + Intronic
1095427290 12:42090260-42090282 TGGAAGAATGCAGTGTCTTTAGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096271322 12:50167907-50167929 AGGGATAAAGCAGTGAAAGTAGG - Intergenic
1096878967 12:54651911-54651933 AGTTAGAATGCAGTAACTTTTGG + Intergenic
1097239541 12:57565690-57565712 AGGGAGGTTGCAGTGACCCTAGG - Intronic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099935864 12:89124577-89124599 AGGGAGAATGAAGTGTGTATTGG - Intergenic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1104704338 12:130932056-130932078 AGTAAAAATGCAGTGACTGCAGG - Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107765752 13:43732797-43732819 AGAGAAAATGCAGTGAGTGTTGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109649915 13:65311151-65311173 AGGAAGAATCCAGTGAGTGATGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111800077 13:92970341-92970363 AGGAAGAATTAAGTGAGTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113080908 13:106518765-106518787 AGGGAAAATGGAGTGGCCGTGGG - Intronic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116490920 14:45502193-45502215 AGGGTGACTGCAGTAACTGCAGG + Intergenic
1116765844 14:49069923-49069945 GGGGAAAACACAGTGACTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117464009 14:55974357-55974379 CAGGAGAATGCAGAGAATGTGGG + Intergenic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1117903696 14:60562394-60562416 ATTCAGAATGCAGAGACTGTAGG - Intergenic
1118149877 14:63178361-63178383 AGGCAGAATCCAGTGTCTGCAGG + Intergenic
1118662462 14:68029045-68029067 AGGGTTAATGAAGAGACTGTGGG - Intronic
1119670445 14:76514287-76514309 AGGGAGATTGGATTGAATGTGGG + Intergenic
1120622044 14:86776043-86776065 GGGCAGAATGATGTGACTGTTGG + Intergenic
1121225240 14:92316987-92317009 AGTGAGAATGCCGTTACTGTGGG - Intergenic
1121803556 14:96795559-96795581 AGGGAGGATGCAGTAACTTGTGG + Intergenic
1124217119 15:27816696-27816718 AGGGAAAATTCAGTAGCTGTAGG - Intronic
1125492396 15:40158061-40158083 CAGGAGAATGGAGTGTCTGTGGG - Intergenic
1126452453 15:48823566-48823588 AGGGAGAATGCAGTGCCTTGGGG - Intergenic
1126489145 15:49216808-49216830 AGGGAGGGTGAAGTGAGTGTGGG - Intronic
1126660829 15:51031470-51031492 AGAGGGACTGCAGTGATTGTGGG - Intergenic
1126979948 15:54229156-54229178 AGAGAGAATGCAGTAATTGCAGG - Intronic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128117337 15:65118157-65118179 AGGAAGATGGCAGTGGCTGTAGG - Exonic
1128643483 15:69357955-69357977 AGGGAGTTAGCTGTGACTGTAGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1129556456 15:76515286-76515308 AGGGTGAGTGCAGTAACTGAAGG + Intronic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1133307956 16:4822973-4822995 AGGGAGAAGGAAGTGACCTTTGG - Intronic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1134796165 16:17038963-17038985 AAGGAGAATGTAGTGCATGTGGG - Intergenic
1136679124 16:31945057-31945079 AGGGAGATTGCAGCAACTGGGGG + Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139659152 16:68409128-68409150 TGGGAAAATGCAGTGCCTGCTGG - Intronic
1140317274 16:73911308-73911330 AGGTAGAGTGCAGTCAATGTGGG + Intergenic
1140688929 16:77462780-77462802 TGGGAGAATGCAGTGTGTTTGGG + Intergenic
1141013333 16:80423951-80423973 AAGGAGAACGTAGAGACTGTGGG - Intergenic
1141087969 16:81110357-81110379 AGGGAAAATGCAGTGAGGGGAGG - Intergenic
1141376604 16:83536490-83536512 AGTGGGAATGCAGTGAGTGTGGG + Intronic
1141521635 16:84584061-84584083 GGGGACAATGCAGTGACCGCTGG - Intronic
1142132283 16:88436541-88436563 AGAGAGAACGCTGTGACGGTGGG + Exonic
1142746476 17:1961391-1961413 AGGGAGACAGCAGTCACGGTAGG + Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144021874 17:11245105-11245127 AGTGAGAAATCAGTGTCTGTGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145328509 17:21851095-21851117 AGGGATACTGCAGTGGCAGTGGG + Intergenic
1145943624 17:28757677-28757699 AGGGCAAGTGCAGTGGCTGTGGG + Exonic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146262875 17:31433221-31433243 AGAGAGAATGCAGTCACTTCTGG + Intronic
1146401500 17:32503480-32503502 AGGGAAAATGCAGTGGAAGTGGG + Intronic
1147661233 17:42118146-42118168 AGAGAGAAGGCAGGGACTGGGGG + Intronic
1148874787 17:50680535-50680557 AGGCAGACTGCTGTGACAGTGGG - Intronic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149466431 17:56883550-56883572 AAGGAGAATGAAGAGACTGAGGG + Intergenic
1149649296 17:58266930-58266952 AGAGAGAAACCAATGACTGTTGG + Intronic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150587447 17:66531661-66531683 AGGGAGACAGCAGTGACAGGAGG - Intronic
1151001958 17:70387949-70387971 AGAGAGAGTGCTGTGTCTGTTGG + Intergenic
1152070285 17:78130872-78130894 AGGGAGAATGCAGAGGGTGAGGG + Intronic
1152891969 17:82887299-82887321 AGGGAAACAGCAGGGACTGTGGG - Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1153970809 18:10225422-10225444 AGGGTCAATGCAGCGACGGTTGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156860732 18:41833427-41833449 ATGGAAAAAGAAGTGACTGTTGG + Intergenic
1157169924 18:45393802-45393824 AGTGAGAACTCAGTGAGTGTTGG - Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1157948966 18:52012809-52012831 AAGCAGAATGCAGTGAATTTTGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1160120311 18:76124568-76124590 GGGGAAAATGCAGAGACTGCAGG - Intergenic
1162592250 19:11599525-11599547 AGGCAAAATGCAGTGTCTCTTGG + Intronic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1164019830 19:21290779-21290801 AAGGAGAATGGCGTGAATGTGGG + Intronic
1164465815 19:28486675-28486697 AGGGAGTCTGCAGTGTCTCTCGG - Intergenic
1166746250 19:45143221-45143243 AGGGAGACAGTGGTGACTGTGGG + Intronic
1167819685 19:51915903-51915925 AGTATGACTGCAGTGACTGTGGG - Intronic
1168448961 19:56448178-56448200 AGGAAGAATGGAGTGATGGTGGG + Intronic
925064082 2:915391-915413 CGGAAGAATGCAGTGACCCTGGG - Intergenic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925377666 2:3399915-3399937 TGGGAGCACGCAGTGACTGAGGG - Intronic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925699059 2:6614370-6614392 ACGGAGAGTGCTGTGAGTGTGGG - Intergenic
927170510 2:20365538-20365560 AGGAAGAATGCAGCTACTATGGG - Intergenic
928603997 2:32927361-32927383 AGGCAGCATGAAGGGACTGTTGG + Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930606188 2:53495908-53495930 AAGGATAATGCAATGAGTGTTGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
933770502 2:85741226-85741248 ATGGAGTCTGCAGTGGCTGTCGG - Intergenic
934541786 2:95181343-95181365 ACCAGGAATGCAGTGACTGTGGG + Exonic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935018945 2:99212132-99212154 AGGGAGAATGAAGTGATCATGGG - Intronic
935263310 2:101373729-101373751 AGGGAGAAAGAAGTGACTGCAGG + Intronic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935805632 2:106744835-106744857 AAGGAAAATGAAGTGAGTGTTGG - Intergenic
935924257 2:108050418-108050440 AGGGTGAATGGAGTCACTGCTGG - Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936538824 2:113333652-113333674 AGAGAGCACGCAGTGAGTGTGGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937145656 2:119642030-119642052 AGTGAGAATGCAGTTACCTTGGG + Intronic
937379708 2:121365523-121365545 AGGGTGAAGACATTGACTGTTGG - Intronic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
937667009 2:124499361-124499383 ATGGAGAAGGCAGCCACTGTGGG + Intronic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939501851 2:142996625-142996647 AGGGAACAGGCAGTAACTGTGGG + Intronic
939708027 2:145479185-145479207 AGGAAGACTGCAGTGACTAAGGG - Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941515295 2:166466055-166466077 ATGGAGTATGCAGTTGCTGTGGG - Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941907796 2:170733878-170733900 AGGGAGAAAGCCCTGACTTTGGG - Intergenic
941950057 2:171145904-171145926 ATGGAGAAGGTAGTGACTGATGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943192998 2:184704780-184704802 AGGGACAATGCATTGACACTGGG + Intronic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944129785 2:196335327-196335349 AGAGAAATTCCAGTGACTGTAGG - Intronic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
945946823 2:216002787-216002809 AGGGAGAAAGGAGGGACTGAAGG - Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171415698 20:24979226-24979248 AGGTAGACTCCAGTGGCTGTAGG - Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172980390 20:38937269-38937291 TGGGAGAGTGCCATGACTGTGGG + Intronic
1173391416 20:42638047-42638069 AGGGAGAAATCAGTCACAGTAGG + Intronic
1174212304 20:48889787-48889809 AAGAAGAAGGCAATGACTGTTGG - Intergenic
1174427357 20:50441589-50441611 AGGGAAAGTGCAAAGACTGTGGG - Intergenic
1175454009 20:59096092-59096114 GGAGAGCAGGCAGTGACTGTGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177105068 21:16945487-16945509 AGGAAGAGTGCAGAGACCGTGGG + Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178477728 21:32952062-32952084 AGGGAGAAAGCAGTGAGAGCCGG + Intergenic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181519169 22:23435481-23435503 AGGGAGTGTGCAGTGACATTGGG + Intergenic
1181725887 22:24810646-24810668 GGGGAGAATGCAGGGGCTGGTGG + Intronic
1182357991 22:29730829-29730851 AGGGAGAAGGGAGTGAGCGTGGG + Exonic
1182554773 22:31123179-31123201 AGGGAGCCTGCAGTGTATGTGGG - Intronic
1182785276 22:32902300-32902322 AGGGAGAATGTAGTCAGTGAGGG + Intronic
1183181062 22:36259929-36259951 AGGGAGAATGCAGAGACCACAGG + Intronic
1183756220 22:39768330-39768352 AGGGAGAATGGCCTGACTGAGGG - Intronic
1184421577 22:44385461-44385483 AGGGGGAGTGCAGCCACTGTGGG - Intergenic
949448644 3:4162612-4162634 GAGGACAATGCAGTGACTGAAGG - Intronic
949792988 3:7813779-7813801 GGAGAGAATGCAGTGTCTGTAGG - Intergenic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952810747 3:37400409-37400431 AAGTAGAATTCAGTGACTATTGG - Intronic
952862280 3:37823054-37823076 AGGGAGAATACAGAGCCAGTAGG + Exonic
952999248 3:38916816-38916838 GGGGAGGAAGCAGTGACTGGAGG + Intronic
953899494 3:46831706-46831728 AGGGAGATTGCACTGCCTGGGGG - Intronic
954413578 3:50381905-50381927 AGGGAGAATGGGGTAACTGATGG - Intronic
954429141 3:50459942-50459964 AGGGTGGAAGCAGTGCCTGTGGG - Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954521911 3:51235808-51235830 ATGGAGAATGCAGTCAATGAGGG - Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958576957 3:95962715-95962737 AGTGAGTATTCTGTGACTGTTGG - Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958743161 3:98099315-98099337 AGGGAAAATGTACTGTCTGTGGG - Intergenic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959210412 3:103371709-103371731 AGGGAAAATGCAGTCAATTTAGG + Intergenic
959448400 3:106468064-106468086 ATTGATAATGCAGTGACTGTGGG - Intergenic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959913841 3:111794297-111794319 AGAGAGGGTGCAGTGACTGCGGG - Intronic
960265978 3:115621582-115621604 AGGGAGGAGGCAGAGAATGTGGG - Intergenic
961225107 3:125237105-125237127 AGGGAGACTGAATTGACTGAAGG + Intronic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964253588 3:154749446-154749468 AAGGAGAATGCAATGATTATGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966106796 3:176345538-176345560 AGGAATGATGCAGTCACTGTTGG + Intergenic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967012093 3:185445216-185445238 AGGTAGAATGCAGTAACCTTTGG - Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968762679 4:2450709-2450731 AGGGAGGGTGCAGGGCCTGTGGG - Intronic
968936305 4:3612253-3612275 CAGGAGGAGGCAGTGACTGTGGG + Intergenic
969048186 4:4353609-4353631 GGAGAGAATCCAGTGGCTGTGGG + Intronic
969762342 4:9197792-9197814 ACCAAAAATGCAGTGACTGTTGG + Intergenic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974047036 4:56907355-56907377 AGGGGGAATGCAGTCAGTTTGGG - Intergenic
974070603 4:57119821-57119843 ATGGAGAATGCACTGAGTGAGGG - Intergenic
974266905 4:59597704-59597726 AAGGATAGTGCAGGGACTGTGGG + Intergenic
975095753 4:70454453-70454475 AGGGAGCATGCAGTGCCTGTGGG - Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978387864 4:108193797-108193819 AGTAAGAATGAAGTGACTGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979929536 4:126613837-126613859 AGGGAAAATGCTGTGAATTTGGG - Intergenic
980421422 4:132565914-132565936 AGGCAGAATGCTCTGACAGTGGG + Intergenic
980562068 4:134490657-134490679 AGGGACATTGCAGTAACTTTGGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984493553 4:180467965-180467987 AGGTAGAATGCAGAAACTGTAGG - Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
984938890 4:184914316-184914338 AGGTAGGATCCAGTGAGTGTAGG + Intergenic
985030282 4:185782027-185782049 AGGCAGAATGCAGTACCTGCGGG - Intronic
985613576 5:905468-905490 AGGGAGTCTGAAGTGACTGAAGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987023576 5:13900084-13900106 AGGATGAATGGAGTGACTGAGGG - Intronic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
989465980 5:41756399-41756421 AGGCAGAATGCATGGACTCTGGG + Intronic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990299790 5:54438455-54438477 AGGGATAATGCAGTGTCTCCAGG - Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991411264 5:66347778-66347800 GGGGAGAATGGTTTGACTGTTGG + Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993107114 5:83612054-83612076 AAGGAGACTTCAGTGCCTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993252514 5:85547858-85547880 AGGGAGAAGGAAGTGAGTGTAGG + Intergenic
993256985 5:85604471-85604493 AGGGAGGGAGCAGTGACGGTGGG + Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
994613728 5:102077939-102077961 AGGGAGGATGCAGTGGCGCTAGG - Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998182362 5:139954366-139954388 AGGAAGAATGAAATGACTGGAGG + Intronic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000063371 5:157675247-157675269 AGGGAGAATGAAATGAATATGGG - Intronic
1000608718 5:163352108-163352130 AGGGAGAACCCAGAGAATGTAGG + Intergenic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1001900436 5:175422420-175422442 AGGGAGAATCCACAGGCTGTGGG + Intergenic
1003167724 6:3695914-3695936 TGGGAGGATGCAGTGGCTGTGGG + Intergenic
1003425997 6:5998924-5998946 CGGGAGCATGGAGTGAGTGTGGG + Exonic
1005162562 6:22881167-22881189 AGAGAGAATGCCAGGACTGTAGG + Intergenic
1006336848 6:33425453-33425475 AGGGAGAATGGAGGAACTGAAGG + Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009045987 6:58237895-58237917 AGGGTGAATGAAGGGACTGGAGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010756499 6:79671477-79671499 TAGGTGAAAGCAGTGACTGTTGG + Intronic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012827233 6:104162173-104162195 AGGGAGAACGCAGTGACCATGGG + Intergenic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG + Intergenic
1015246864 6:131084688-131084710 AACGAGAATGAACTGACTGTAGG - Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016012259 6:139149576-139149598 AGGGAGTTTGCAGTGAATGCCGG + Intronic
1016086684 6:139923444-139923466 AGGGAGATAGCAGTGGCTGCAGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016514861 6:144882561-144882583 AGGCAGAATCCAGAGACTGGAGG + Intergenic
1017650389 6:156576169-156576191 GGGGAGAGTGAAGTGAGTGTGGG + Intergenic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1017786707 6:157762691-157762713 AGGGAGGATGCAGTGGGGGTTGG + Intronic
1017823728 6:158066633-158066655 AGGGTGAGGGCAGTGACTTTGGG + Exonic
1017869969 6:158478968-158478990 GCTGAAAATGCAGTGACTGTGGG + Intronic
1018105778 6:160484911-160484933 AGGCAGAATGCAGTATCTCTAGG + Intergenic
1018648310 6:165968829-165968851 AGGCAGAAGGCAGAGCCTGTAGG + Intronic
1019087001 6:169487947-169487969 AGAGAGAGTGCTGTGTCTGTGGG - Intronic
1019592112 7:1840845-1840867 AGGGAGTGTGCAGTGACATTGGG - Intronic
1019676469 7:2315988-2316010 ATGCAGGATGCAGTGAGTGTGGG - Intronic
1019739778 7:2666822-2666844 AGGGAGAATTTCCTGACTGTTGG - Intergenic
1019771484 7:2886354-2886376 CGGGGGAATTCAGTGACCGTGGG + Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021295525 7:18901524-18901546 TGGGAGAATCCAATGCCTGTAGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026023000 7:66725351-66725373 GGGCAGAATGGAGGGACTGTGGG - Intronic
1026353767 7:69539861-69539883 AGGGAGAATGCATTCCATGTAGG - Intergenic
1026427918 7:70315126-70315148 AGGCAGAATGCGGTCACTGGTGG - Intronic
1026902567 7:74045193-74045215 GGGGACAAAGCAGTGAGTGTAGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027768374 7:82375276-82375298 GTGGAGAATGCAGTCACTGGTGG + Intronic
1028299657 7:89181496-89181518 AGGGAGACTGCAGGGACCGTGGG - Intronic
1028341616 7:89728732-89728754 AGGGCGACTGCAGTAACTATAGG - Intergenic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035173314 7:157032981-157033003 AGGGTGAAAGCAGTGACCGGGGG - Intergenic
1035367935 7:158360902-158360924 AGGGTGGATGCAGGGTCTGTGGG - Intronic
1035368001 7:158361147-158361169 AGGGTGGATGCAGGGTCTGTGGG - Intronic
1035368029 7:158361241-158361263 AGGGTGGATGCAGGGTCTGTGGG - Intronic
1035417239 7:158699966-158699988 CTGCAGAGTGCAGTGACTGTTGG + Intronic
1035745388 8:1958950-1958972 GTTGAGACTGCAGTGACTGTGGG - Intergenic
1036272430 8:7319538-7319560 ACCAAAAATGCAGTGACTGTTGG + Intergenic
1036348918 8:7990802-7990824 ACCAAAAATGCAGTGACTGTTGG - Intergenic
1036420256 8:8588838-8588860 AGTGAGATTGCATTGCCTGTGGG + Intergenic
1036571027 8:9979984-9980006 AGGGAGGAGGCAGTGGCTGGAGG + Intergenic
1036844179 8:12151279-12151301 ACCAAAAATGCAGTGACTGTTGG - Intergenic
1036865553 8:12393600-12393622 ACCAAAAATGCAGTGACTGTTGG - Intergenic
1037456247 8:19067406-19067428 CTGGAGAATGCAATGACTCTTGG - Intronic
1037858548 8:22388698-22388720 AGGGAGAAAGCAGAGGATGTGGG + Intronic
1039130419 8:34257590-34257612 AGAGAGAATGAACTCACTGTAGG + Intergenic
1039392085 8:37189463-37189485 AGAGAGAATGGAGAGAGTGTGGG + Intergenic
1040290557 8:46121957-46121979 GGCGAGAATGCAGGGAATGTTGG - Intergenic
1040300072 8:46183398-46183420 AGTGAGACTGCAGTGAATGCTGG - Intergenic
1040315164 8:46257131-46257153 AGGGAGACTGCAGGGAATGCTGG + Intergenic
1041081793 8:54221511-54221533 AGGGAGACTGCAGAGTCTGCAGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041857670 8:62476945-62476967 AGGAAGAATGCTGTGACTTCAGG + Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043561874 8:81502557-81502579 AGGGAGACTGCTGTGGGTGTGGG - Intergenic
1043819704 8:84847288-84847310 AGGCTGAGTGAAGTGACTGTGGG - Intronic
1044149320 8:88754849-88754871 AAGGACAATTCAGTGAGTGTGGG - Intergenic
1044225619 8:89714678-89714700 CAGTAGAATGCAGAGACTGTTGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045322387 8:101091848-101091870 GGGGAGAAGGCAGTAACTGATGG - Intergenic
1046634103 8:116653050-116653072 AAGGGGAAAGCAGTGACAGTAGG + Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047929146 8:129709149-129709171 AGGGGGAATTCAGTGACAGCTGG - Intergenic
1047996704 8:130343366-130343388 AGGGAAAAAGGAGTGAGTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048477836 8:134759015-134759037 AGGGAGAAGGGACTGACTATTGG + Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1052938801 9:34115634-34115656 GGGGAGACTGCAGAGACTATAGG - Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1055181509 9:73393406-73393428 AGGGAGGCTGAAGTGACTGAAGG - Intergenic
1055977051 9:81965779-81965801 AGGGAGCAAGATGTGACTGTTGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056338703 9:85602853-85602875 AGAGAACATGCAGTGACTGTGGG + Intronic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058770251 9:108224053-108224075 GGAGACAATGCAGTGATTGTAGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1060199645 9:121645141-121645163 AGGGAGAAAGGAGGGGCTGTGGG + Intronic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060369840 9:123058080-123058102 AGGGAGAATGCTGTTTCTTTAGG + Intronic
1061233410 9:129328124-129328146 AGGGACAACTCAGTGGCTGTGGG + Intergenic
1062051690 9:134450581-134450603 ATGGGGAAGGCAGTGAGTGTGGG + Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1187075693 X:15932229-15932251 AGGGAGAATGCAGTACCTGAGGG + Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187713419 X:22076990-22077012 AGGAAGAAGCCAGTGCCTGTGGG + Intronic
1188112792 X:26212034-26212056 GGAGAGAACGCAGTGACTGGAGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1190092134 X:47448351-47448373 CGTATGAATGCAGTGACTGTGGG - Exonic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190685635 X:52870306-52870328 AGGGAGGATTCAGGGTCTGTTGG + Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193440952 X:81538647-81538669 AGAGAAAATGAAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194329120 X:92559648-92559670 AGGAATATTGCAGTGACTGGGGG + Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1194921475 X:99771447-99771469 AGGGAGAAGGGAGTGAAGGTAGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196224161 X:113146027-113146049 AGGAAGAATGGGGTGACTGGGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196740753 X:119023928-119023950 AGAGAGGATGCAGTAAGTGTTGG - Intergenic
1196928183 X:120654966-120654988 AGTGTTAATGCAGTGCCTGTGGG - Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197030595 X:121809192-121809214 AGGGACAGTGAAGTGAATGTGGG - Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197657597 X:129133937-129133959 AGGGAGAAAGTACTGACTGTAGG + Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198134810 X:133738313-133738335 AGGGAGAAAGCAATGACAGTGGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199431839 X:147770667-147770689 AGAGAGAGTTCAGTGGCTGTGGG + Intergenic
1199685826 X:150264337-150264359 AGTGAGAACCCAGTGTCTGTGGG - Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1201179404 Y:11331812-11331834 ATGAAGAAGGCAGTGCCTGTGGG - Intergenic
1201517627 Y:14835272-14835294 AGGGAGGATGAAGGGACTGAAGG + Intronic