ID: 1051466516

View in Genome Browser
Species Human (GRCh38)
Location 9:17384174-17384196
Sequence TTAGCTCGCTGGATGAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051466516_1051466523 27 Left 1051466516 9:17384174-17384196 CCCTGATTCATCCAGCGAGCTAA No data
Right 1051466523 9:17384224-17384246 TTAAAGACATTTTATTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051466516 Original CRISPR TTAGCTCGCTGGATGAATCA GGG (reversed) Intronic