ID: 1051466516 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:17384174-17384196 |
| Sequence | TTAGCTCGCTGGATGAATCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051466516_1051466523 | 27 | Left | 1051466516 | 9:17384174-17384196 | CCCTGATTCATCCAGCGAGCTAA | No data | ||
| Right | 1051466523 | 9:17384224-17384246 | TTAAAGACATTTTATTTTTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051466516 | Original CRISPR | TTAGCTCGCTGGATGAATCA GGG (reversed) | Intronic | ||