ID: 1051467660

View in Genome Browser
Species Human (GRCh38)
Location 9:17398915-17398937
Sequence TTTTTGGCAGAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 0, 2: 10, 3: 71, 4: 540}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051467660_1051467666 -2 Left 1051467660 9:17398915-17398937 CCTTCTTCCCTCTCTGCCAAAAA 0: 1
1: 0
2: 10
3: 71
4: 540
Right 1051467666 9:17398936-17398958 AAGGGATAAAAACTAATCACTGG No data
1051467660_1051467668 29 Left 1051467660 9:17398915-17398937 CCTTCTTCCCTCTCTGCCAAAAA 0: 1
1: 0
2: 10
3: 71
4: 540
Right 1051467668 9:17398967-17398989 TGAGTCCCTAATGAGCCTGGAGG No data
1051467660_1051467667 26 Left 1051467660 9:17398915-17398937 CCTTCTTCCCTCTCTGCCAAAAA 0: 1
1: 0
2: 10
3: 71
4: 540
Right 1051467667 9:17398964-17398986 ACTTGAGTCCCTAATGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051467660 Original CRISPR TTTTTGGCAGAGAGGGAAGA AGG (reversed) Intronic
901330949 1:8408100-8408122 TTTGTGGCAGAGAGAGACAAGGG - Intronic
902358614 1:15928081-15928103 TTTTTGGCAGAGAGGAACGAAGG + Exonic
902393781 1:16121015-16121037 ATGATGGCAGAGAGGGGAGAGGG + Intergenic
902998903 1:20250344-20250366 TTTTTGGGAGAAAGGGAAGAAGG + Intergenic
903405057 1:23089043-23089065 TTATTGGCACAGGAGGAAGAAGG - Exonic
903836123 1:26204236-26204258 TGTTGGCCAGAGAGGGAAGAAGG + Intergenic
903838740 1:26223218-26223240 TTTTAGGCAGACCAGGAAGAAGG + Intergenic
903978276 1:27166417-27166439 GTTGTGGCAGAGGGGGAAAAAGG - Intronic
904752917 1:32752279-32752301 CATTTTGCAGGGAGGGAAGAGGG + Intronic
904767174 1:32859157-32859179 GTTTTTGCAGAGGGGGAAGATGG + Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
905471639 1:38196592-38196614 TTTCAGGCAGAGCAGGAAGAGGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906751860 1:48270738-48270760 TTTTTTGTGGAGTGGGAAGATGG - Intergenic
906812690 1:48845183-48845205 TTTTTTTCAGATAGGGAACAAGG + Intronic
906950443 1:50330969-50330991 TTTTTTATAGAGTGGGAAGACGG - Intergenic
909694434 1:78450161-78450183 CATTTGACAGAGAAGGAAGATGG - Intronic
909800735 1:79804590-79804612 TCCTTAGCAGACAGGGAAGAAGG - Intergenic
910471871 1:87562227-87562249 TTTTTGGCTGATAATGAAGAGGG - Intergenic
910712146 1:90193217-90193239 TTTGTGACAGAGAAGGAAAAAGG + Intergenic
911605967 1:99905524-99905546 ATTTCAGCAAAGAGGGAAGATGG - Intronic
912986806 1:114441715-114441737 CATTTGGCAAAGAGGGCAGATGG - Intronic
913069930 1:115289653-115289675 TTGTATGCAGAGAAGGAAGATGG - Intronic
913227563 1:116713470-116713492 TTTGTGGCCGAGGGAGAAGAGGG - Intergenic
914772170 1:150697358-150697380 TTGGTGGAAGAGAGGAAAGAGGG + Intergenic
914829553 1:151160736-151160758 TTTTTGGCAGACAAGGAGGCTGG + Exonic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915320603 1:155054012-155054034 TTTTTGGCTTAGGGGAAAGAGGG + Intronic
915422733 1:155797673-155797695 TTTTTGGTAGAGACGGGAGGGGG - Intronic
915492662 1:156259859-156259881 TTTTTATTTGAGAGGGAAGAAGG - Intronic
915675194 1:157523341-157523363 ATTTTGGTAGACAGGGAATATGG - Intronic
915716218 1:157947564-157947586 GTTTTGACAGAGAAGGAACAAGG + Intergenic
916170638 1:161999147-161999169 TTTTGAGCAGAGATGGAATATGG + Intronic
916801216 1:168218148-168218170 TTTGTGTCAGAAAGGTAAGAGGG - Intergenic
917485156 1:175448861-175448883 TTTTTGGCATGGAGGGAAGCAGG - Intronic
917777875 1:178357603-178357625 TTTTTGGCTGAGAGTACAGAGGG - Intronic
917871369 1:179244907-179244929 CTTTTGACAGAAATGGAAGAAGG + Intergenic
918789564 1:188808905-188808927 CTTTTGGAAGAGAGGTAAGGAGG + Intergenic
919713732 1:200753732-200753754 TGAATGGAAGAGAGGGAAGAAGG - Intronic
920768916 1:208861572-208861594 TTTTTGTCAGAAAGGGATGCTGG - Intergenic
921561209 1:216660413-216660435 TTTAAGGCAGAGAGAGAATAAGG + Intronic
921693114 1:218176183-218176205 TTTTAGACATAGAGGGAAAACGG + Intergenic
923339533 1:232995842-232995864 TTATAGGAAGAAAGGGAAGAAGG + Intronic
923653882 1:235898863-235898885 TTTGTGTCAGAAAGGTAAGAAGG - Intergenic
924027729 1:239853807-239853829 TTTATGGCTTAGAGGCAAGATGG - Intronic
924172851 1:241359041-241359063 ATTTTGGCATAAAGGGAAGAAGG - Intergenic
1062963560 10:1591320-1591342 TTTTTGAGAGGGAGGAAAGAAGG - Intronic
1063854524 10:10233796-10233818 TTTTTAACTGAGAGGGAAAATGG - Intergenic
1064936725 10:20686568-20686590 TTTTTTCCAAAGAAGGAAGAGGG + Intergenic
1064977942 10:21137759-21137781 TTTTTTGTAGAGATGGCAGAGGG - Intronic
1065170286 10:23020302-23020324 TTTTTAGTAGAGATGGATGATGG + Intronic
1065705696 10:28469791-28469813 TTTTTTGCAGAGAGAGACGGAGG + Intergenic
1065875309 10:29992809-29992831 TTTTAGGCAGATAGGGAAAGCGG - Intergenic
1067143778 10:43678801-43678823 TGGTGGGCAGACAGGGAAGATGG - Intergenic
1067511754 10:46901360-46901382 TTTATGGCAGGGAGGAAGGATGG - Intergenic
1067650493 10:48150464-48150486 TTTATGGCAGGGAGGAAGGATGG + Intergenic
1068011554 10:51457773-51457795 TATTTGGCAGTCAAGGAAGATGG - Intronic
1068423960 10:56832105-56832127 CTTTTGGCAAAGTGGGAAGAGGG - Intergenic
1068506231 10:57902973-57902995 TTGTTGGCAGGAAGGTAAGATGG + Intergenic
1068745511 10:60525889-60525911 TTATTTGCAGAAAGGGGAGATGG + Intronic
1069167593 10:65182028-65182050 TTTTAGGTAGAGTGGGAAAAGGG - Intergenic
1069746805 10:70720260-70720282 AGCTTGGCAGAGAGGGAAGATGG + Intronic
1070106085 10:73432720-73432742 TTTCTGGCAGAAAAGAAAGAAGG + Intronic
1070279342 10:75037531-75037553 TTTTTTGGTGAGAAGGAAGAGGG - Intergenic
1070326429 10:75392495-75392517 ATTTTGGTAGAAAGGGAAAAAGG + Intergenic
1070600392 10:77862236-77862258 TTTTAGGGAGAGAGATAAGATGG - Intronic
1071791975 10:88964569-88964591 TTCTTGGTAGAGAGGGAAGGAGG + Intronic
1072071594 10:91923584-91923606 TATTTGACAGAGAAGGAAAAAGG - Intergenic
1072298927 10:94040332-94040354 ATTTAGGCAGAAAGGGAGGAGGG - Intronic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1072605791 10:96981642-96981664 TTCTTCCCAGAGAGTGAAGATGG - Exonic
1072761818 10:98062939-98062961 TTTCTGGGAGGGAGGGGAGAAGG - Intergenic
1072945878 10:99809555-99809577 TCTTTGGAAGAGAGGGAAGTAGG + Intronic
1073021849 10:100451714-100451736 TTTTTGGCAGTGATGAAAAATGG - Intergenic
1074257882 10:111821554-111821576 TTTTTGGCACAGTGGGGACATGG - Intergenic
1074844746 10:117387759-117387781 TCTTTGTGTGAGAGGGAAGAAGG + Intergenic
1075043287 10:119125685-119125707 TTTTTGGTAGAGAGTAGAGATGG + Intronic
1075162567 10:120037442-120037464 TTCCTGGTAGAGAGGGAAGGAGG + Intergenic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075623734 10:123946983-123947005 GTCTTGGGAGAGAGGGAAGAGGG + Intergenic
1076403278 10:130196935-130196957 TTTGGGGCAGACAGGGAATATGG - Intergenic
1076907186 10:133368610-133368632 TCCATGGCAGAGAGGGAACATGG - Intronic
1077973774 11:7224351-7224373 TTTTAGGCAGTTAGGGAAAATGG - Intergenic
1078148306 11:8737489-8737511 GTTTTGGTAGAGAGGTAGGAAGG + Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078935179 11:15943260-15943282 TTGGTGACAGAGAGGAAAGAGGG + Intergenic
1079465020 11:20721896-20721918 TTCTTGGCAGAGGGGGAGGGCGG + Intronic
1080416880 11:32077264-32077286 TTTTTGTCAGAGAGGTAGAAAGG - Intronic
1080609507 11:33891932-33891954 GTCCTGGCAGAGAGGGGAGATGG - Exonic
1080672993 11:34398485-34398507 TTTTTTGCAGAGATGGTAGAGGG - Intergenic
1080927332 11:36771037-36771059 TTTATGGTAGAAAGGGAATATGG - Intergenic
1081565841 11:44260583-44260605 TTTTTGGGAGAGGAGGAACACGG - Exonic
1081734626 11:45394308-45394330 TTGTGGGCACAGAGGGTAGAGGG + Intergenic
1081952732 11:47059349-47059371 TTTTTGGCAGAGAGGGGGTGGGG - Intronic
1082131056 11:48489803-48489825 TTCTTTGAAGAAAGGGAAGATGG - Intergenic
1082728285 11:56763942-56763964 ATTTTGTTAGAGAGGGAACATGG - Intergenic
1082803268 11:57429898-57429920 TTATGGACAGAGTGGGAAGATGG + Intergenic
1083538283 11:63491300-63491322 TTTTAGGCGGAGAGGGGCGAAGG + Intergenic
1083743088 11:64721478-64721500 CTTTTGGGAGACAGGGGAGAAGG - Intronic
1084509047 11:69591605-69591627 TGGCTGGCAGAGGGGGAAGATGG - Intergenic
1085389242 11:76174060-76174082 TAGCTGGTAGAGAGGGAAGAGGG + Intergenic
1085678233 11:78545702-78545724 TTTTTAGTAGAGATGGGAGATGG + Intronic
1085734482 11:79027449-79027471 TTTTTGGCTGAGAGCGATGTAGG + Intronic
1086498279 11:87426111-87426133 TTTTTTGCAGTGATGGAAGTGGG + Intergenic
1086648531 11:89256928-89256950 TTTTGAGCAGAGAGGGATGTAGG + Intronic
1087846720 11:102982035-102982057 TTCCTGGTAGAGAGGGAAGGGGG + Intergenic
1087928401 11:103947471-103947493 TTTCTGACAGACAGGGAAAAGGG + Intronic
1088742482 11:112778396-112778418 TTTTTGGCAGGGCGGGGAGCGGG + Intergenic
1089391486 11:118104889-118104911 TTTTTAGGAAAGAGAGAAGAAGG - Intronic
1089561920 11:119347415-119347437 AGTTTGGCAGGGAGGGAAGTGGG + Intergenic
1089592944 11:119556389-119556411 TTGGTGGCAGAGAGGGGAGAAGG + Intergenic
1089679335 11:120110642-120110664 ATGATGGTAGAGAGGGAAGAGGG - Intergenic
1089932622 11:122329311-122329333 TACTTTGCAAAGAGGGAAGAGGG + Intergenic
1090552906 11:127842316-127842338 GTTTAGGGAGAAAGGGAAGAAGG - Intergenic
1091404901 12:203234-203256 TTTTTTGTAGAGACGGGAGAAGG + Intronic
1091419955 12:328224-328246 TATCAGGCAGAGAGGGAGGAGGG + Intronic
1091610601 12:2004428-2004450 TGTCTGGGAGGGAGGGAAGATGG - Exonic
1092746504 12:11677281-11677303 TTATTGGCAGAGAGAGAGGCAGG - Intronic
1092805831 12:12221424-12221446 TGTGTGTCAGAGAGGGAAGAGGG - Intronic
1093286900 12:17275372-17275394 TTTGTGGTAGAAAGGGAATATGG + Intergenic
1093703968 12:22254513-22254535 TATCTGGGTGAGAGGGAAGAAGG - Intronic
1093930641 12:24951999-24952021 CTTTCAGCAGAGAGGGAAGCGGG + Intergenic
1094492976 12:30972775-30972797 TTCTTGGCAAAGAGGAAAGCCGG + Intronic
1095305737 12:40637201-40637223 ATTATGGCAGAAAGGGAAGCAGG + Intergenic
1095464658 12:42477587-42477609 TTTGTAGCACAGAAGGAAGAAGG + Intronic
1095616713 12:44198833-44198855 TGTCAGGCAGAAAGGGAAGAAGG + Intronic
1095744410 12:45641549-45641571 TATTTGGTAGAGAGTGAGGAGGG - Intergenic
1096583311 12:52602164-52602186 TATCTGGGAGGGAGGGAAGAAGG + Intergenic
1097354768 12:58588893-58588915 TTTTTGTAAAAGAGGCAAGAGGG - Intronic
1097531352 12:60804188-60804210 TATAAAGCAGAGAGGGAAGAAGG + Intergenic
1097806376 12:63969071-63969093 GTTTTCACAGAGAAGGAAGATGG + Intronic
1097849336 12:64395959-64395981 TTCTTGGCAGAGAAAGAAGTTGG - Intergenic
1098167784 12:67715809-67715831 GTGATGGCAAAGAGGGAAGAGGG + Intergenic
1098878189 12:75889041-75889063 TATTTGTCAGAGAGGGAAGGAGG - Intergenic
1099853437 12:88134259-88134281 TTGTTGGAGGAGAGGGAGGATGG - Intronic
1100447929 12:94678470-94678492 CTTTTTGCAGATAGAGAAGAGGG - Intergenic
1100715974 12:97306121-97306143 ATGATGGCAGAGAGGAAAGAAGG - Intergenic
1101140537 12:101791242-101791264 TTTTTGGTAGTGAGAGAAAAGGG - Intronic
1101285386 12:103306707-103306729 TTTTTGGCAGGGAGGGGAGGGGG - Intronic
1101590084 12:106117717-106117739 TATTTGGCAGAGAATGAAGCTGG - Intronic
1101852915 12:108418584-108418606 TTTTTGGTAGAGAAGGATGCTGG - Intergenic
1102220171 12:111188815-111188837 TTGTTGGAAGAGAGGGCAGCAGG + Intronic
1102549064 12:113677839-113677861 TTTTTGGCAGAGAGTGAGGGCGG + Intergenic
1102581324 12:113890116-113890138 TTTTGGGCAGCGAGGGAGGGGGG - Intronic
1102641075 12:114367138-114367160 TTTTGGGCAGAGAGAATAGAGGG + Intronic
1102663416 12:114549195-114549217 TTTTTAGCAGAGAGGGGACATGG + Intergenic
1102922566 12:116803140-116803162 TATTTGTCAGAGAAGGAAGTTGG + Intronic
1102950280 12:117026513-117026535 TTCTTGGAAGTGAGGGAAGCTGG - Intronic
1103001793 12:117390344-117390366 TTTGGGACAGAGTGGGAAGAAGG + Intronic
1103361651 12:120358200-120358222 TGTTTTCCAAAGAGGGAAGAAGG + Intronic
1103774168 12:123353161-123353183 TTTTGGGCAGGGAGTGAGGAAGG + Intronic
1105693934 13:22870079-22870101 AGTTTGGCAGAGAAGAAAGAGGG + Intergenic
1107697455 13:43014031-43014053 TTTAGGACAGAGAGAGAAGAGGG + Intergenic
1108171409 13:47745611-47745633 TTTCCTGCAGAGAGGGAAGAGGG + Intergenic
1108285168 13:48899362-48899384 TTTTAGGCAGAGAGAACAGAAGG - Intergenic
1108650392 13:52472618-52472640 TTTTTGGGAGAAAGGGATGTTGG - Intronic
1108800117 13:54084538-54084560 TCTTTGGCAGGGAGTGTAGAGGG - Intergenic
1109760611 13:66823354-66823376 TTTTTAGGAAAGAGAGAAGAAGG + Intronic
1109801512 13:67384324-67384346 TTTTTGGCATAGATGGAATAAGG - Intergenic
1110119063 13:71859887-71859909 TTTTTGGCAGATTGAGAAGAAGG + Intronic
1110437036 13:75486607-75486629 TTTTGGGCAGAGACAAAAGATGG + Intergenic
1110508133 13:76314392-76314414 ATATGGGCAGAGAGGGAAAAGGG + Intergenic
1111102452 13:83605939-83605961 CTTCTGGCAGAGAAGGAAAAAGG + Intergenic
1112937444 13:104818973-104818995 TTCTTGGGAGAGAAGGAAGATGG - Intergenic
1113255067 13:108496575-108496597 TTTTCTGCAGCCAGGGAAGACGG - Intergenic
1113291276 13:108909514-108909536 TTTCTGGCAGTGAGGGACCATGG + Intronic
1113504514 13:110806013-110806035 TTGTGGGCAGAGAGGGAAAGTGG + Intergenic
1114186584 14:20407027-20407049 TAATTGGCAGAGACAGAAGAGGG + Intronic
1114742448 14:25111651-25111673 ATTCTGGCAGTGAGGGAAGGAGG + Intergenic
1115378249 14:32703159-32703181 TTGGAGGCAGAGTGGGAAGAAGG + Intronic
1115746310 14:36441292-36441314 TTTGAGGAAGAGAGGGAAAATGG + Intergenic
1115876393 14:37866511-37866533 ATTTTGGCAAAGAGTGAAGATGG + Intronic
1115880889 14:37916983-37917005 TATTGGGATGAGAGGGAAGAAGG + Intronic
1115901455 14:38154105-38154127 TATTTGGGAAAGAGGGTAGAAGG + Intergenic
1116782278 14:49250078-49250100 TTTTTTGCGGGGAGGCAAGATGG + Intergenic
1117746291 14:58872858-58872880 TTGCTGGCAGAGGGGTAAGATGG + Intergenic
1118284786 14:64461587-64461609 TTTTTGGCAGGGGGGGTAGGGGG + Intronic
1118689813 14:68327289-68327311 TTTTTGGTGGAGAGGGGTGAGGG + Intronic
1118888518 14:69887412-69887434 TTTTTGGGGGAGAGGGAGGATGG + Intronic
1119065629 14:71523268-71523290 TATTTGGCATAGAGAGAAAAAGG + Intronic
1119778275 14:77261436-77261458 TGTTTGGAGGGGAGGGAAGAGGG - Intergenic
1120755025 14:88234799-88234821 TTTTCAGCAGAGCTGGAAGAAGG + Intronic
1121145624 14:91579629-91579651 TCTTTGCCAGCGAGGGCAGAGGG - Intergenic
1121663305 14:95652117-95652139 TCTCTGTCAGAGAGGAAAGAGGG + Intergenic
1121757381 14:96414407-96414429 TCTCTGGCACAGAGGAAAGATGG + Intronic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1124132318 15:27001832-27001854 TTTTAGGAAGAGATGGCAGAAGG + Intronic
1125933403 15:43615816-43615838 GTGGTGGCAGAGAGGGCAGAAGG + Exonic
1125946501 15:43715278-43715300 GTGGTGGCAGAGAGGGCAGAAGG + Intergenic
1126160874 15:45612277-45612299 TTTTTGGCAGAGATGGGGGGGGG - Intronic
1126405818 15:48321475-48321497 TACTTGGCAGGGAGGGAATAGGG - Intergenic
1126442774 15:48709384-48709406 TTTTTTGTAGAGATGGAAGCGGG + Intergenic
1127214978 15:56814731-56814753 TTTGTGGCAGATAGAGCAGAGGG + Intronic
1128005769 15:64238969-64238991 TTTTTGGTAGTGATGGCAGAAGG - Intronic
1128557456 15:68641434-68641456 TTTGGGGGAGAGAGGAAAGAAGG + Intronic
1128854842 15:71001313-71001335 TTGTTGGCAGTGAGAGAAGTAGG + Intronic
1129119035 15:73383888-73383910 CTTGTGGCAGAGGAGGAAGAGGG + Intergenic
1129552486 15:76468210-76468232 TTTGTGGCAGTGAGTGAAGGAGG - Intronic
1129974600 15:79811716-79811738 TGTTTTGCAGAGAGGGAAATAGG - Intergenic
1130387208 15:83422374-83422396 GTTTTGCCAGAGAAGGAAGCTGG + Intergenic
1133551872 16:6863938-6863960 ATTTTGCAAGAGAAGGAAGAAGG - Intronic
1133662447 16:7931926-7931948 TTTGTGTGAGAGAGAGAAGAAGG - Intergenic
1133791575 16:9013282-9013304 GTGCTGGCAGAGAGGGGAGAGGG - Intergenic
1135640932 16:24119334-24119356 TTTTTGGGGGGGTGGGAAGAGGG - Intronic
1136470063 16:30473955-30473977 TTTTTTGCAGAGAGGCCAAACGG + Intronic
1136924773 16:34361993-34362015 TCTCTGGCAGAGAGGGAGAAAGG - Intergenic
1136979800 16:35049813-35049835 TCTCTGGCAGAGAGGGAGAAAGG + Intergenic
1137245950 16:46705121-46705143 TTTTTGACAGAGAGGTAGGCAGG - Intergenic
1137557609 16:49482647-49482669 TGTTTGACAGTGAGGGAAGCTGG - Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138099987 16:54244627-54244649 GTTGTGGCAGGCAGGGAAGATGG - Intergenic
1139242506 16:65407936-65407958 ATTTTGGTAGAGAGGGCAGTAGG + Intergenic
1139392359 16:66612901-66612923 TTTTTGGCAGAGACGTTAAAGGG - Exonic
1141188760 16:81808368-81808390 TTTTAGAGAGAGAGGGAGGAGGG + Intronic
1141614007 16:85199999-85200021 TTTATGGCAAAAAGAGAAGAGGG - Intergenic
1141685658 16:85568406-85568428 TTCTTGTCACAGAGGCAAGATGG + Intergenic
1141776614 16:86127374-86127396 GTGTTGGCGGAGAGGGAAGGGGG + Intergenic
1141861679 16:86721277-86721299 TTTTTGGCAGAAAGAGAAACTGG + Intergenic
1141867834 16:86762885-86762907 TTTTGTGCAGACAGGGAGGAAGG + Intergenic
1143242768 17:5457979-5458001 ATTTTGGAAGAGAGGGGAAAGGG + Intronic
1143690561 17:8560852-8560874 TCTTTGGCAAAGTGAGAAGAGGG + Intronic
1143770449 17:9165210-9165232 TGTTTCCCAGAGAGGCAAGAAGG + Intronic
1144249694 17:13403256-13403278 TTTGAGGAAGTGAGGGAAGAGGG - Intergenic
1144383824 17:14730277-14730299 CTTTTGGGAGAGAGGGTGGAGGG - Intergenic
1144389686 17:14781670-14781692 TTTTAGGCAGAGAAGAATGATGG - Intergenic
1144593592 17:16546112-16546134 TTTTAGGCAGAGAGGCAAAGGGG + Intergenic
1145021205 17:19432620-19432642 TTTGTGTGAGAGAGGAAAGAGGG + Intergenic
1145350642 17:22079374-22079396 TTCCTGGCAGAGAGTAAAGAAGG - Intergenic
1145740806 17:27272749-27272771 TTTTTGGTAGAGACGGGAGACGG + Intergenic
1145985469 17:29043070-29043092 GGCTTGGCAGAGAGGGAAGCGGG + Exonic
1147162899 17:38578358-38578380 TCTGGAGCAGAGAGGGAAGAAGG - Intronic
1147169204 17:38608412-38608434 TTTGGGGAAGAGAGGGCAGAAGG - Intergenic
1148527369 17:48353435-48353457 TGTTTGGGAGAAAGGAAAGATGG - Intronic
1149230339 17:54526389-54526411 TTTTAGGCACAGAGGGTAGAAGG + Intergenic
1149380539 17:56088870-56088892 TTATTGGCCCAGAGGGAAAAAGG + Intergenic
1149706507 17:58699652-58699674 TTCCTGTAAGAGAGGGAAGATGG - Intronic
1150011377 17:61507513-61507535 TTTGTGGCAGAGATCGCAGATGG + Intergenic
1150059989 17:62059363-62059385 TTCTTGGTAGTGAGGGAAGAGGG - Intronic
1150914754 17:69425251-69425273 TTTGTGGCAGAGGAGGTAGATGG + Intronic
1151095084 17:71488153-71488175 TTTTTAAAAGAGAGAGAAGATGG - Intergenic
1151240793 17:72756206-72756228 TATTTGGCAGAGACAGAAAACGG - Intronic
1152018077 17:77765076-77765098 TTTTGGTCAGAGAGAGAAGGAGG - Intergenic
1152411720 17:80127961-80127983 TTTTTGGGAGAGTGGGGATAGGG - Intergenic
1153303285 18:3610465-3610487 GTTATGGCAGGGAGGGGAGAGGG - Intronic
1155029453 18:21971603-21971625 TTTTTGGGAGACAGGGAAGAGGG - Intergenic
1156008812 18:32472492-32472514 TTTTTAGTAGAGACGGGAGACGG - Intergenic
1156285878 18:35695436-35695458 TTATGGGCTGAGAGTGAAGAAGG + Intronic
1156398938 18:36723560-36723582 CTTTTGGCAGGGAGCGAGGAGGG + Intronic
1156989632 18:43393350-43393372 TTCTTGGCAGAGAGAAAAGTTGG - Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157011130 18:43650236-43650258 GTTTTGGGAGAGAGGAAGGATGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157619620 18:49008813-49008835 TGCCTGGCAGAGAGGGAAGGGGG + Intergenic
1157913227 18:51639078-51639100 TTTTTTGCTGAGAGGGAAAGTGG - Intergenic
1158260114 18:55597386-55597408 TCTTTGGGGGAGAGGGAAGGGGG - Intronic
1158292779 18:55960047-55960069 TTGTTGGAAGAGAAGGGAGACGG + Intergenic
1159978213 18:74742142-74742164 GTTTTGGCAGAGAAGGAAGATGG + Intronic
1161203853 19:3029972-3029994 TTTTTTGCAGAGATGGAGTAGGG + Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1162437922 19:10673935-10673957 TTTTTGGCAGAGGGGGGTGTGGG + Intronic
1162475087 19:10895050-10895072 TCTTTGGCAGATAGAGAATAAGG - Intronic
1163278323 19:16299888-16299910 TTTTTGGTGGGGAGGGCAGAGGG - Intergenic
1164554781 19:29243184-29243206 TGTATGGGAGACAGGGAAGAAGG - Intergenic
1165401167 19:35601260-35601282 GTTTTAGGAGAGAGGGAACAGGG - Intergenic
1165797134 19:38525930-38525952 GTCTTGGCAGGGAGGGAAGGAGG - Intronic
925876688 2:8317326-8317348 TTTTCAGGAGAGAGGGAACATGG + Intergenic
925878261 2:8329966-8329988 TTCTGGGCACAGAAGGAAGATGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928115992 2:28545578-28545600 TTTTTGGCAGGTAGAGAAAATGG - Intronic
929126415 2:38526594-38526616 TTTTTGTTAGAAAGGGAGGAGGG + Intergenic
929209227 2:39335620-39335642 TTTTTGTCAGAAATGGAAGTTGG - Intronic
930276641 2:49319043-49319065 TATTTAGCAGAGAGTGAAGATGG - Intergenic
930301652 2:49623177-49623199 TTGTTGTCAGAGTGGGTAGAAGG + Intergenic
930568817 2:53058580-53058602 TTTGTGTCTGAAAGGGAAGAAGG + Intergenic
931322262 2:61182550-61182572 TTTTTGGCAGAGAGGAAAATTGG - Intronic
931472188 2:62549422-62549444 TTTTAGGGAGAGATGGCAGATGG - Intergenic
931575160 2:63710968-63710990 TTTTTGTCAGAGTGGCAACAGGG + Intronic
932148755 2:69348751-69348773 ATTTTGGCAGAAATGGAGGATGG - Intronic
932503986 2:72211076-72211098 TTTCAGGTTGAGAGGGAAGAGGG - Intronic
933455952 2:82519425-82519447 TATTTGACACAGAGGAAAGAAGG - Intergenic
934100899 2:88652084-88652106 TGTTTGGCAGAGAGGAAGGGTGG + Intergenic
935180882 2:100690286-100690308 TTAATGGCAAAGAGGGGAGAGGG + Intergenic
935350217 2:102145990-102146012 TTCTTGGCACAGAGAGAAGTGGG + Intronic
935428768 2:102950273-102950295 TCTCTGGCAGAGAGGAAACAGGG + Intergenic
936826406 2:116587114-116587136 TTTTTGGAAGAGAGTGGGGAGGG + Intergenic
937400867 2:121582472-121582494 TTTTTGGAAGGAAGGAAAGAAGG + Intronic
939133846 2:138271450-138271472 TTTTAGGCAGAGAGGAAAAGGGG + Intergenic
939147272 2:138431078-138431100 TGTTATGCAGAAAGGGAAGAAGG + Intergenic
939265850 2:139871996-139872018 TTTTAGGCAGATAGGAAAAAAGG + Intergenic
939697076 2:145339928-145339950 TTTCTGTCACAGAGGGAATACGG - Intergenic
939789208 2:146550479-146550501 TTTTACACAGATAGGGAAGAGGG + Intergenic
939915815 2:148041779-148041801 GTTTTTGGAGAGAGGAAAGATGG - Intronic
940152933 2:150622749-150622771 TTTATGGCAGAAAGTGAAGCAGG - Intergenic
940174970 2:150868869-150868891 TTTCTGGCAGAGAGGGGAGGAGG - Intergenic
940335583 2:152523945-152523967 TTATTGGCAGAGAGGGCAGAAGG + Intronic
940357360 2:152758727-152758749 TCTGTGGCAGAGATTGAAGAAGG - Intronic
940703783 2:157078611-157078633 TTTTTGGCAAAGAAGAAAAACGG - Intergenic
942070528 2:172311850-172311872 CTTCTGGAAGAGAGGGCAGAGGG + Intergenic
942128268 2:172849084-172849106 TTTTTAGCAGAGAGGTATGAGGG + Intronic
942543965 2:177043616-177043638 TTTTGGGGAGAGAGGGAGAAAGG - Intergenic
942590884 2:177545799-177545821 TTTTTGCCAGACAGGCAAGAAGG + Intergenic
942659340 2:178247584-178247606 GTTGTGGCAGTGAAGGAAGAAGG - Intronic
943312350 2:186342333-186342355 CTTTAGGCAGAAAGAGAAGAGGG + Intergenic
943387146 2:187216071-187216093 TTGTGGGCAGAGTGGGAGGAGGG + Intergenic
943901381 2:193442096-193442118 TTTTTGGCAAAGATGGAAGGGGG - Intergenic
944044419 2:195392300-195392322 TTTATTGCAGAGAAGGAATATGG + Intergenic
944194875 2:197041780-197041802 ATTTTTGAAGAGAGGTAAGATGG - Intronic
944454033 2:199875135-199875157 TTTAAAGGAGAGAGGGAAGATGG + Intergenic
944538679 2:200736483-200736505 TATTTGACACAGAGGGAAAAGGG - Intergenic
944843424 2:203645124-203645146 TTTATGGCAGAGAAGAATGAAGG - Intergenic
945108212 2:206337164-206337186 TTCTTGGGAGTGAGGGAAGCAGG + Intergenic
945259163 2:207828375-207828397 TTTCTGGCAGAGACTGAACATGG - Exonic
946162876 2:217846768-217846790 CTTTTGGGAGAGAGGAAAGTGGG - Intronic
946666958 2:222060471-222060493 TCATGGGCAGAGAGGGAAGGAGG + Intergenic
946683179 2:222239332-222239354 TTTTTTTCAGAGAGAGAAGGAGG + Intronic
946809879 2:223512450-223512472 TTTGTGGAAGAAAGGGAAGGAGG + Intergenic
946957548 2:224948211-224948233 TTTGTGCCAGACAGGGAAAAAGG + Intronic
948049934 2:234972456-234972478 TTTTTGGTAGAGATGGAGGAGGG + Intronic
1170122210 20:12923621-12923643 TCTTTGGCACACAGGTAAGAAGG - Intergenic
1170933885 20:20793250-20793272 TTGTTGGCAGAGAGAAAAGCGGG + Intergenic
1171275375 20:23852278-23852300 TGATTAGCAGAGAGGAAAGAAGG + Intergenic
1171324903 20:24282719-24282741 ATATTGGCAGGGAGGGCAGAGGG + Intergenic
1171560891 20:26124364-26124386 TTCCTGGCAGACAGTGAAGAAGG - Intergenic
1172778218 20:37420353-37420375 AGTTTGCCAGAGGGGGAAGAAGG - Intergenic
1174206994 20:48847347-48847369 TTTTTATAAGAGAAGGAAGAGGG - Intergenic
1174984880 20:55439892-55439914 TTTTTGACAGATGGGGAGGAAGG + Intergenic
1175699835 20:61128934-61128956 TTGATGGCAGAGATGGAAGAGGG + Intergenic
1175884267 20:62279972-62279994 ATTTAGGCTGAGAGTGAAGAGGG - Intronic
1177219575 21:18174062-18174084 TTTTTGGCAGGGAGGTAGAAGGG + Intronic
1177364875 21:20121629-20121651 TTTTTGCAACAGAAGGAAGAAGG + Intergenic
1178080755 21:29062231-29062253 TTTTTGATAGAAAAGGAAGATGG - Exonic
1178356930 21:31917142-31917164 TGTTTGGCAGGGAAGGAGGAGGG + Intronic
1178424760 21:32470564-32470586 GTGTTATCAGAGAGGGAAGATGG - Intronic
1178524998 21:33320247-33320269 TTTTTGGTGGGGAGGGGAGAGGG - Intergenic
1178634347 21:34289231-34289253 GTCTTGGCAGAAAGGGAAGGAGG + Intergenic
1179381491 21:40903357-40903379 TTTTTGGCAGAGAGAGGACAGGG - Intergenic
1179877283 21:44275497-44275519 TTCCTGGCAGAGAGGGGAGGTGG + Intergenic
1180743343 22:18069135-18069157 TTTTTTTCAGAGAGGAAGGAGGG - Intergenic
1181042951 22:20201465-20201487 GTTTAGGCAGAAAGGGAGGAAGG - Intergenic
1181116119 22:20633379-20633401 AGTTGGGCAGAGAGGGAGGAGGG - Intergenic
1181295266 22:21833186-21833208 TTTTCGGGAGTGAGCGAAGACGG - Intronic
1181855091 22:25775551-25775573 GATTTGGCAGCGAGGGAAGAGGG - Intronic
1181945046 22:26510008-26510030 TTTAGGGAAGAGGGGGAAGATGG - Intronic
1181961013 22:26621912-26621934 TTATAGGCAGGGAGGGAAGAGGG - Intergenic
1182558503 22:31141619-31141641 TGTGTGGCAGAGGGGGAAGGGGG + Intergenic
1183087217 22:35493802-35493824 CTTCTGAGAGAGAGGGAAGAAGG - Intergenic
1183136023 22:35888625-35888647 CTCATGGCAGAAAGGGAAGAGGG + Intronic
1183232435 22:36591371-36591393 GTTCTAGTAGAGAGGGAAGAAGG + Intronic
1183805244 22:40203848-40203870 TGTTAGTCAGAGAGGGAGGAGGG + Intronic
1183913570 22:41098140-41098162 TTTTTAGCAGGGAGGGGAGAGGG - Intronic
1183917388 22:41132793-41132815 TTTATGACTGAGAGGGAAGAGGG + Intronic
949563303 3:5222427-5222449 TTTGTGTGAGAAAGGGAAGAGGG + Intergenic
949672765 3:6418313-6418335 ATTTGGGCAGAGAGGTCAGAAGG + Intergenic
949674013 3:6432287-6432309 TTGGTGGCAGAGTGTGAAGAGGG - Intergenic
949883557 3:8678769-8678791 TAAGTGGCAGGGAGGGAAGAGGG - Intronic
951221063 3:20069426-20069448 TTCTTGTTAGAGAGGGAAGTGGG + Intronic
951342082 3:21500783-21500805 TTTTAGGCAGAGAGGAAAATGGG + Intronic
951400584 3:22228082-22228104 TGATTGACAGAGAGGCAAGATGG + Intronic
951724609 3:25743312-25743334 TTGAGGTCAGAGAGGGAAGAGGG - Intronic
951830627 3:26922368-26922390 TTTTTGGCAGAGAGTCAATAAGG - Intergenic
952255302 3:31690000-31690022 AGGTTGGCAGAGAGGGAAGAAGG + Intronic
952551327 3:34481396-34481418 TTTGTGGGAGGGAAGGAAGAAGG - Intergenic
955115252 3:55992012-55992034 TTGTTGGCAGTGAGAGAACATGG - Intronic
955342478 3:58135814-58135836 TTTTTGGTAGGGAGAGTAGAGGG - Intronic
955690280 3:61583986-61584008 TTTTTGGCAGGCAGGGGAGAAGG - Intronic
956347067 3:68292065-68292087 TTTTTGGCTAGGAGGGGAGATGG - Intronic
956910334 3:73809649-73809671 TTTTTGGGGGATGGGGAAGAAGG + Intergenic
957996086 3:87691752-87691774 TTTTTGGCAGAGAGTAAAAAAGG - Intergenic
958783653 3:98573558-98573580 TTTTTGGCAGGGAGTGGAGGAGG - Intronic
960678999 3:120227295-120227317 TTATTGGCCAAGAAGGAAGAAGG - Intronic
960933083 3:122874392-122874414 TCTTTGGCAGAGGGAGCAGAAGG + Intronic
961021131 3:123508064-123508086 TTTAGGGCAAAGAGGGAAAAGGG + Intronic
961057968 3:123804847-123804869 TGATTGGAGGAGAGGGAAGAAGG + Intronic
962168615 3:133077258-133077280 ATTTTTGCAGAGAGGAAAAAGGG + Intronic
963431602 3:145213185-145213207 ATTCTGGCAGAGAAGGTAGAGGG - Intergenic
963455668 3:145543502-145543524 TTTTTTTCAGAAAGGGAAGCTGG + Intergenic
963727101 3:148934908-148934930 TTTATTGCAGAGAAGTAAGAAGG - Intergenic
964020615 3:152005757-152005779 TTTTTAGTAGAGACGGGAGATGG - Intergenic
964814516 3:160702413-160702435 TTTTTTCCAGAGAGGGAAATAGG - Intergenic
965181741 3:165412911-165412933 TTCTTGCCAGAGGAGGAAGATGG - Intergenic
965573331 3:170192906-170192928 TTTTTTGCAGGGAGGGGACAGGG + Intergenic
966716574 3:183018727-183018749 TCTTCCCCAGAGAGGGAAGAGGG + Intronic
968850710 4:3075518-3075540 TTCTAGTCTGAGAGGGAAGAGGG + Intronic
970251047 4:14116436-14116458 TTTGTGTGAGAGAGGTAAGAGGG + Intergenic
971004913 4:22362516-22362538 TTTTTGAAAGGGAGGGAGGAGGG - Intronic
971821909 4:31568110-31568132 TTTTTGGCATAGAGGAAAATGGG - Intergenic
971845995 4:31918130-31918152 TTTGAGGCAGACAGGGAAGGTGG - Intergenic
972562181 4:40238498-40238520 TCTTTGCCAGAGTGGGCAGAAGG + Intronic
974356417 4:60818544-60818566 TTTTGAACAGAGAGGGAATATGG - Intergenic
974776125 4:66483775-66483797 ATTATGGCAAAGAGTGAAGAGGG - Intergenic
975317393 4:72970250-72970272 TTTTTGGCAGGGAGAGAAAGAGG + Intergenic
975905096 4:79200377-79200399 GTTCTGGGAAAGAGGGAAGAAGG + Intergenic
976229412 4:82825693-82825715 TTTTAGGCAAAGAGGAAAAAAGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
977064679 4:92299789-92299811 ATTTTAGAAGGGAGGGAAGAGGG + Intronic
977522634 4:98104277-98104299 TTTCAGGCAATGAGGGAAGATGG - Intronic
977544848 4:98365442-98365464 TTTTTTGTAGAGAGGGGATAGGG - Intronic
977554150 4:98471717-98471739 ATTTTGGCAGGGTGAGAAGAAGG + Exonic
978066395 4:104408448-104408470 TGGATGGCAGAGAGGGAAGAAGG - Intergenic
978277400 4:106968183-106968205 ATGTAGGCAGAGAGGGAAAAAGG + Intronic
978879505 4:113684649-113684671 TTCTGGGCAGAAAGGCAAGATGG - Intronic
978990492 4:115076080-115076102 TTGTTGGGAAAGAGGGAACAAGG - Exonic
980134293 4:128845368-128845390 TTTTTGGCAGAGTGGGGAGAGGG + Intronic
980729136 4:136804668-136804690 CTTTCAGCAGAGAGGGGAGATGG - Intergenic
981220671 4:142229836-142229858 TTTTGGGGGGATAGGGAAGAAGG + Intronic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
981968468 4:150635457-150635479 TTAGAGGCAGAGAGGGAAAATGG - Intronic
982018794 4:151182870-151182892 CTTGTGGCAGAGAGGTAAAATGG - Intronic
982878452 4:160677291-160677313 TATTTGGAAGTGAGGGAAGGAGG + Intergenic
983130736 4:164016221-164016243 ATTATGGCAGAAAGGGAAGCAGG + Intronic
983775260 4:171598254-171598276 TTTTAGGCAGTTAGGGAAAAAGG - Intergenic
985298957 4:188466997-188467019 TGTGTGGCCGAGAGGCAAGAGGG + Intergenic
986526222 5:8680242-8680264 TTTTGGGAAGAGAAGGAAGAAGG - Intergenic
987476878 5:18401479-18401501 TTTTTGGCCTGGAGGCAAGAGGG - Intergenic
987520041 5:18970064-18970086 GTTTCAGCAAAGAGGGAAGATGG + Intergenic
987525822 5:19047675-19047697 TTTTAGGCAGAGAGGAAAAGGGG - Intergenic
988219359 5:28322218-28322240 GTTTTGTCAGGGAGGGAAGAAGG + Intergenic
988389716 5:30612126-30612148 TTTTTGCAAGAGAGTGAAGATGG + Intergenic
988692291 5:33584972-33584994 TCCTTGGCAGAAAGGGAAGTGGG - Intronic
989209701 5:38846533-38846555 GTGTTGGGAGAGAGGAAAGAGGG - Intronic
989249215 5:39289320-39289342 CTTCTGGAAGAGAAGGAAGAAGG - Intronic
989724825 5:44575456-44575478 GTTTTGACAGACAGGGAAAAGGG + Intergenic
990457796 5:56004970-56004992 ATTTTGGAAGAGAAGGAAGAGGG + Intergenic
990850442 5:60196986-60197008 TTTTTGCCAGAGAGGCAGAATGG - Intronic
991163410 5:63532586-63532608 TATTTGCCAGAGAGGTAAGGTGG + Intergenic
991448621 5:66727683-66727705 TTTTTTGGAGGGAGGGGAGAGGG + Intronic
991992675 5:72356876-72356898 TATTTGGAAGAGGTGGAAGAGGG + Intronic
993134612 5:83943376-83943398 TTTTAGGGAAATAGGGAAGAGGG + Exonic
993138587 5:84001538-84001560 TTTTTGGCAGTGGGGGAGTAAGG - Intronic
993328237 5:86567694-86567716 TGTTTGTCAGAGAGAAAAGATGG - Intergenic
993373908 5:87126637-87126659 TTTTTGGAAGGAATGGAAGAAGG + Intergenic
993491209 5:88552271-88552293 TTTTTGAGAGACAGGGGAGAAGG - Intergenic
993621768 5:90177097-90177119 TTTTTGGTGGGGAGGGGAGATGG - Intergenic
994190036 5:96859268-96859290 TTTTTGGCAGTGTGGAAGGAAGG - Intronic
994251290 5:97540549-97540571 TTTTGGGCAGAAAAGGAAAAAGG - Intergenic
994316294 5:98337392-98337414 TATTTGGCTGAGAGTGTAGATGG - Intergenic
994434024 5:99706039-99706061 TTCTCAGCAGAGAGGGAAGCTGG - Intergenic
995123877 5:108561002-108561024 TTTTTGGCAGAATGGGAAGTAGG + Intergenic
995356544 5:111243623-111243645 ATATTGGCAGAGAGGGAAATTGG - Intronic
995495551 5:112738123-112738145 TTTTTGACAGAAGAGGAAGAAGG + Intronic
995708892 5:115014711-115014733 CTTTTGGCAGAGAGTATAGATGG + Intergenic
995843051 5:116463111-116463133 TTTTTGACAAAGAGAGAATAGGG - Intronic
996435024 5:123424495-123424517 TTTTGGGCAGAAAGCAAAGAAGG - Intergenic
997487138 5:134240712-134240734 TTTACTGCAGAGAGGGAAGGAGG - Intergenic
997944633 5:138189030-138189052 TTGTTAGCAGAGAGTGAAGCAGG + Exonic
998270127 5:140698993-140699015 TTTTTGGAAGACAGCAAAGAGGG + Exonic
998630406 5:143891828-143891850 TTCTTCACAGACAGGGAAGAGGG + Intergenic
998633760 5:143929795-143929817 TATTTTGCAGAGAAGGAAAAAGG - Intergenic
999793213 5:154962822-154962844 TTATTGGCTGAGAGTGATGAAGG + Intronic
999961816 5:156764041-156764063 TTCTTGGGACAGGGGGAAGAGGG - Intronic
1000057296 5:157618710-157618732 CTTTTAGCAGAGAGGGGACATGG + Intergenic
1000096244 5:157973364-157973386 TTGTTGGAAAAAAGGGAAGAAGG - Intergenic
1000128695 5:158273655-158273677 TTTTTGAGGGTGAGGGAAGAGGG + Intergenic
1000196028 5:158958700-158958722 TTTATGACATAGAGGGGAGAAGG + Intronic
1000770504 5:165347440-165347462 TTCTTGACAGAGAGGGAAGAGGG - Intergenic
1001002295 5:168019054-168019076 ATTTTGGCAGAAGGGAAAGAGGG + Intronic
1001557610 5:172647233-172647255 CTTAGAGCAGAGAGGGAAGAGGG + Intronic
1001894244 5:175364743-175364765 TGGTTGCCAGGGAGGGAAGAGGG - Intergenic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002598325 5:180338761-180338783 TTTTTGTCACAGGAGGAAGAAGG - Intronic
1002809847 6:616916-616938 TTTTTAGTAGAGAGGGAGGAGGG + Intronic
1003140297 6:3465783-3465805 ATTCTGCCAGAGAGAGAAGAGGG + Intergenic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003368971 6:5506327-5506349 TTTTTAGCAGAGAGAAAACAAGG + Intronic
1003383767 6:5648814-5648836 TGTTTGCCAGTGAGGGGAGAGGG - Intronic
1003663569 6:8087894-8087916 TTTTTTCCACAGGGGGAAGATGG + Intronic
1004272008 6:14203994-14204016 GATTTGGAAGAGAGGAAAGAGGG - Intergenic
1004290127 6:14359129-14359151 TTCCTGGCAGAGAGGGGAGAAGG - Intergenic
1004515157 6:16316261-16316283 TTTTTGGCAGGATGGGAAGAGGG - Intronic
1005210365 6:23453629-23453651 TCTTTGGCAGAGAAGGAAGAAGG - Intergenic
1005252105 6:23959104-23959126 TTTGTGTCAGAAAGGGGAGATGG - Intergenic
1005390702 6:25330403-25330425 TTTTGGGGAGCCAGGGAAGAAGG + Intronic
1005607856 6:27493346-27493368 TTTTTAGAAGAGAGGGATGGAGG - Intergenic
1005821096 6:29599916-29599938 TTTTTGGCACTGAGGCAAAATGG - Intronic
1006185984 6:32182044-32182066 TTTTTAGCTCAGAGGGAAGAAGG + Intronic
1007518252 6:42430376-42430398 CTTTTTGGAGTGAGGGAAGATGG - Intronic
1007688891 6:43685061-43685083 TTACTGGTGGAGAGGGAAGAGGG + Intronic
1009497328 6:64367490-64367512 TTTTGGAAAGAGAGGGAGGATGG + Intronic
1009704645 6:67231329-67231351 TTTATGGCGGAAAGGGAAGCAGG - Intergenic
1009796766 6:68479432-68479454 TTTTTGGTAGAGAGGGCAGATGG - Intergenic
1009847964 6:69157603-69157625 TGTGTGGCAGAGGGGGAGGAGGG + Intronic
1009948177 6:70364297-70364319 CTTTTGCCAGAGAGGGCAAAGGG + Intergenic
1010089627 6:71965300-71965322 TTTTTGGGAGGGAGGGTAGAAGG + Intronic
1010581937 6:77610007-77610029 TTTTCAGCAGAGAGGTAACATGG + Intergenic
1010726537 6:79341239-79341261 TTTTTGGAAGAGACAGAAGCAGG + Intergenic
1010935439 6:81855251-81855273 TGTTTGGCAGAGAGAAAAAAGGG - Intergenic
1011714994 6:90096260-90096282 TTCTAGGCAGAGAGAGAAGCAGG - Intronic
1011781101 6:90790249-90790271 TCTTTGTCAGAGAGGGAAGGTGG + Intergenic
1012386210 6:98686104-98686126 TTTTTGGTAGAGAAGCAAGAGGG - Intergenic
1012971911 6:105740111-105740133 TTTTAGGGTAAGAGGGAAGAGGG + Intergenic
1013389255 6:109666646-109666668 TTCTTGGCACAGTGGGAAGAAGG + Intronic
1013582763 6:111552375-111552397 TTTATTGCTGACAGGGAAGAGGG - Intergenic
1013838701 6:114363589-114363611 CATTTGGCAGAGAGGCAAGTTGG + Intergenic
1014150937 6:118054638-118054660 TTAGTGTCAGAAAGGGAAGAAGG - Intronic
1014288224 6:119527740-119527762 TTTTTAGCTGCGAGGGAAAAGGG - Intergenic
1015712154 6:136153880-136153902 TTTTTAGCAGAGAGCAGAGATGG - Intronic
1016425762 6:143934381-143934403 ATATTGAAAGAGAGGGAAGATGG - Intronic
1017259847 6:152373194-152373216 TTTTTGTCAGAAAGTGAAAATGG - Exonic
1017910509 6:158788324-158788346 CTTTTGGGTGAGTGGGAAGAGGG - Intronic
1017947694 6:159109089-159109111 ATTTTGTTAGAGAGAGAAGAGGG + Intergenic
1017951469 6:159138483-159138505 AGTTTGGCATAGAGGAAAGAGGG + Intergenic
1018271969 6:162089445-162089467 TTATTGGCAGAAAGGGAAATTGG + Intronic
1018464955 6:164035477-164035499 TTTTTTGCAGAGATGGGGGAGGG + Intergenic
1019076855 6:169394841-169394863 TCTTCAGCAGAGAGGGAACATGG + Intergenic
1020350207 7:7210916-7210938 TTTTAGGCAGAGAAGAAAAAGGG - Intronic
1021055940 7:16046276-16046298 TTTCTGGCAATGAGGGAAGTGGG - Intergenic
1021667774 7:23003524-23003546 TGTTTGGGAGAGAGGAAAGAGGG - Intronic
1021817098 7:24457908-24457930 CTTATGGAAGAGAGGAAAGAAGG - Intergenic
1021931900 7:25589412-25589434 TTTCTGGGAGAGAAGGAAAAGGG - Intergenic
1022259182 7:28687763-28687785 TTTTGGGCAGAGGTGGAAGTGGG + Intronic
1022435763 7:30383361-30383383 TTTGGGGCAAAGAGGGAAGGGGG - Intronic
1022609089 7:31850603-31850625 TGTTTGGAAGAGAGGCAAGAGGG - Intronic
1023168031 7:37362610-37362632 TTTGAGGGAGGGAGGGAAGAAGG - Intronic
1024019935 7:45359593-45359615 TTTTCAGGAGAGAAGGAAGAGGG + Intergenic
1024945973 7:54807707-54807729 TTTTTTGCAGAGACGGCAGGGGG - Intergenic
1025276943 7:57591003-57591025 TTCCTGGCAGAGAGTAAAGAAGG + Intergenic
1026019586 7:66697071-66697093 TGGTTGACACAGAGGGAAGATGG - Intronic
1026992962 7:74598043-74598065 TTTTTTGCAGAGACGGAGGGAGG - Intronic
1027271092 7:76519345-76519367 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027320855 7:77009280-77009302 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027438327 7:78191023-78191045 TCTTTGGTAGAGATGGAAGTTGG + Intronic
1027708749 7:81570213-81570235 ATTTTGGCACAGAGAGAAGCAGG - Intergenic
1027905153 7:84171024-84171046 TTTTTGGCAGAGAGAAAAGAAGG + Intronic
1028252045 7:88548030-88548052 TGGCTGGCAGAGAGGGAAGATGG + Intergenic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028707182 7:93863610-93863632 TAATTAGCAGAGAGGTAAGATGG + Intronic
1028831951 7:95337958-95337980 ATTATGGCAGAGGGGGAAGCAGG + Intergenic
1029873000 7:103715657-103715679 ATTTTGGAAGTGAGGGAAGAGGG - Intronic
1030087590 7:105830194-105830216 TCTATGGCAGAGCTGGAAGAGGG + Intronic
1030205095 7:106944707-106944729 TTTTTGTCACTGTGGGAAGAGGG - Intergenic
1030424615 7:109358579-109358601 TTTTTGTGAGAGAGAGAAAAAGG + Intergenic
1031381850 7:121095870-121095892 TTTTTGGCAGCAAGGTAAGAGGG + Intronic
1031433732 7:121706833-121706855 TTTTTGAGAGAGAGGAAGGAAGG - Intergenic
1031963149 7:128007604-128007626 TTTTAGGCAAAGATGGAAGAAGG + Intronic
1033035931 7:137876363-137876385 TGTGTGTCAGAGAGAGAAGAAGG + Exonic
1033538618 7:142335201-142335223 TTTTGGGCTGAGAGGTCAGAAGG + Intergenic
1033970958 7:147038982-147039004 TTGTTGGAAGAGTGTGAAGAAGG - Intronic
1034328354 7:150258674-150258696 ATTTTGGCAGAGGGGTGAGAGGG - Intronic
1034764860 7:153710790-153710812 ATTTTGGCAGAGGGGTGAGAGGG + Intergenic
1034912806 7:155011412-155011434 TTTGTGACTGAGAGGGAACATGG - Intergenic
1035415096 7:158676883-158676905 TTTCTGTAAGAGAGGGAATAAGG + Intronic
1035993985 8:4525170-4525192 GTTGTGGCATAGAGGGAAGGTGG - Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036027855 8:4929811-4929833 TTTTTGGCAGTGAGGGAATGTGG - Intronic
1036694968 8:10968251-10968273 TCTTTGGTAGAGAGAGAAGTGGG - Intronic
1037020594 8:13965765-13965787 GTTTTGGGAGGGAGGGAGGATGG - Intergenic
1037656561 8:20888735-20888757 ATTTTGGAAAAGAGGGAACAAGG + Intergenic
1037835458 8:22212591-22212613 TGTTTGGTGGGGAGGGAAGAAGG + Intergenic
1037916113 8:22774532-22774554 TTTTAGCCAGAGAGGGAAGGAGG + Intronic
1038452801 8:27650730-27650752 TTGTTGGCATGGAGGAAAGAGGG - Intronic
1039449659 8:37661832-37661854 TTTTTTGGAGATAGGGATGAGGG - Intergenic
1039722541 8:40180022-40180044 TATTTAGCAGGGTGGGAAGAGGG - Intergenic
1040409469 8:47139529-47139551 TTTTTGGTAAAGATGGAAGGGGG + Intergenic
1041039569 8:53833760-53833782 TGATTGGGAGGGAGGGAAGATGG - Intronic
1041047724 8:53903047-53903069 TTTTTGACAGAGAGATCAGATGG + Intronic
1043692104 8:83167689-83167711 ATCATGGCAGACAGGGAAGAAGG - Intergenic
1043798480 8:84577418-84577440 TTGCTGGCAGAGAAGGAAGTTGG + Intronic
1044093404 8:88030497-88030519 TTATTGTCAGAGAGAGAAGCTGG - Intergenic
1044479606 8:92670071-92670093 TTTCTAGCAGAGAGGTGAGATGG - Intergenic
1044853768 8:96453923-96453945 GTTATGGCAGAAAGGGAAGCAGG + Intergenic
1046025727 8:108721259-108721281 TTCTTGGTAGAGAGGAGAGATGG - Intronic
1046217077 8:111162732-111162754 TTTTTGTGAGAAAGGTAAGAGGG - Intergenic
1046302075 8:112307879-112307901 TTTTTGGTCGAAATGGAAGATGG - Intronic
1046409877 8:113827770-113827792 TTCTTGGGAGAGATGGATGAAGG - Intergenic
1046719167 8:117599551-117599573 TTTTTGTGAGGGAGGGAAGAAGG - Intergenic
1046747650 8:117893513-117893535 ATTTGGGCAGTGAGGCAAGAAGG + Intronic
1046762418 8:118035095-118035117 TTTTTGGAAAAGAGAGAAAATGG + Intronic
1047211744 8:122846134-122846156 ATGTTGGCAGAGAGGGGAGGAGG + Intronic
1047987878 8:130254981-130255003 ATTTTCCCAGAAAGGGAAGATGG - Intronic
1048167390 8:132075628-132075650 TTGTTGGCAGTGAAGGAGGAAGG - Intronic
1048334052 8:133490094-133490116 CTTTGGGCAGAGAAGGAAGTTGG + Intronic
1048843322 8:138583742-138583764 ATTTCGGAAGAGAGGGAACATGG - Intergenic
1050997369 9:12237291-12237313 TCTTTGTAAGAGAGGGAAGTTGG - Intergenic
1051350913 9:16197256-16197278 CTTTTGGCTGAGAGGCAACATGG + Intergenic
1051467660 9:17398915-17398937 TTTTTGGCAGAGAGGGAAGAAGG - Intronic
1051770044 9:20567768-20567790 TTTTTGGCTCAGAGTCAAGAAGG + Intronic
1052671558 9:31563948-31563970 TTTTGGGAAGAGACAGAAGAGGG + Intergenic
1054851301 9:69849280-69849302 TTTGTGGAAGAAAGGGAAGAAGG + Intronic
1056019555 9:82427360-82427382 TAATTGGCAGAGAAGGCAGATGG + Intergenic
1056119577 9:83473832-83473854 TTACTGGCAGAGAAGGAAGCAGG + Intronic
1057072277 9:92109655-92109677 TAATTGGCAGAGAAGGCAGATGG - Intronic
1057078374 9:92153408-92153430 TTCTAGGCAGAGAGAGAAGCAGG - Intergenic
1057472169 9:95367660-95367682 AGCTTGGCAGACAGGGAAGAAGG + Intergenic
1058676642 9:107405780-107405802 AGTATGGCAGAGAAGGAAGATGG + Intergenic
1058831130 9:108817491-108817513 TCTTTGGCAGACACAGAAGAGGG - Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059493679 9:114691520-114691542 CTTTTGGAAGAGAAGGAGGAAGG + Intergenic
1059511871 9:114855672-114855694 CATTTTGCAGAGAAGGAAGAAGG + Intergenic
1059904190 9:118963651-118963673 ATTTTGACAGACAGGGAAGAAGG - Intergenic
1061071448 9:128313352-128313374 TTTTTAGTAGAGATGGGAGACGG - Intronic
1061133954 9:128722944-128722966 GATGTGGGAGAGAGGGAAGAGGG + Intronic
1061277714 9:129579026-129579048 TTGTTGGGGGAGAGGGAGGATGG - Intergenic
1185825525 X:3245542-3245564 TGGATGGCAGAGAGAGAAGATGG + Intergenic
1186398933 X:9238789-9238811 TTTTGGGTAGAGGGGGAAGATGG + Intergenic
1186670678 X:11764562-11764584 TCTCAGGAAGAGAGGGAAGAGGG - Intronic
1187244032 X:17538079-17538101 TCTTTCGCAGAGAGGAGAGAGGG + Intronic
1187737890 X:22323009-22323031 TTTTTGGAGGAGAGGGAGAAGGG + Intergenic
1188118041 X:26268966-26268988 TTTTAGTCAGAGGGGGAAAATGG - Intergenic
1188948102 X:36333494-36333516 TTTTTAGGAGAGAGGGAGAATGG - Intronic
1189294069 X:39906524-39906546 TTTTTGGCAGAGCAGGATCAAGG - Intergenic
1190576018 X:51839554-51839576 TTTCTGGCAGAAATGGAGGAAGG - Intronic
1192344034 X:70286617-70286639 TTTTTGGGAGAGAGGCTAGGAGG + Exonic
1192414799 X:70969659-70969681 TTTATGGCAGGGAGGGTTGAGGG - Intergenic
1192479722 X:71474506-71474528 TTATTGGCAGACAAGGAATAAGG + Intronic
1193261361 X:79410333-79410355 CATTTGGCAGATAGGGAAGCTGG - Intergenic
1193397402 X:81001926-81001948 TTGAAGGCAGAGAAGGAAGAGGG - Intergenic
1193601697 X:83514367-83514389 TTTTTGGCGGTGGGGGAAGTGGG + Intergenic
1194629285 X:96263644-96263666 TTTTTGGAAGAAAATGAAGATGG + Intergenic
1194878975 X:99226124-99226146 TTTCTGCCAGTGAGGGCAGAGGG - Intergenic
1195363403 X:104106339-104106361 AGTTTGCCAGAGAGGAAAGAGGG + Intronic
1196481833 X:116159193-116159215 TTTTTGGCTGGCAGGAAAGATGG + Intergenic
1196832588 X:119787825-119787847 TTTTTGGTAGAGATGGACGGGGG + Intronic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198237826 X:134752250-134752272 TTTTTTTTAGAGAGGGAAGTGGG + Intronic
1198657994 X:138935516-138935538 GATTTGGCAGAGTTGGAAGAAGG - Intronic
1198763191 X:140055741-140055763 TTTGTGGTAGAAAGGAAAGAAGG - Intergenic
1199507493 X:148580968-148580990 TATTTGTGAGAGAGGGAAGAAGG - Intronic
1199734171 X:150668514-150668536 TTTTTTGTAGAGATGGAGGAGGG - Intronic
1199834881 X:151579678-151579700 TTATTGGGAGAAAGTGAAGATGG + Intronic
1200342534 X:155413368-155413390 TATGAGGCAGAAAGGGAAGAGGG - Intergenic
1201315533 Y:12641933-12641955 TTCTTGGCAGTGAGCCAAGATGG + Intergenic