ID: 1051467716

View in Genome Browser
Species Human (GRCh38)
Location 9:17399636-17399658
Sequence TATCATCTGTTTACAAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051467716_1051467722 25 Left 1051467716 9:17399636-17399658 CCACCTTTTGTAAACAGATGATA 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1051467722 9:17399684-17399706 TCCTCCCAAAATATAGTTGAAGG No data
1051467716_1051467720 -10 Left 1051467716 9:17399636-17399658 CCACCTTTTGTAAACAGATGATA 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1051467720 9:17399649-17399671 ACAGATGATAACAACTGATGGGG No data
1051467716_1051467721 -4 Left 1051467716 9:17399636-17399658 CCACCTTTTGTAAACAGATGATA 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1051467721 9:17399655-17399677 GATAACAACTGATGGGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051467716 Original CRISPR TATCATCTGTTTACAAAAGG TGG (reversed) Intronic
901483903 1:9544714-9544736 TATCATTTGTTGGCAAAATGTGG + Intronic
906276923 1:44523576-44523598 CCTCATCTCTTTACAAAATGAGG + Intronic
909701584 1:78530371-78530393 TAGCATCTTTTTAAAAAAGTAGG - Intronic
910770720 1:90829011-90829033 TATCATCTGATTACACCAAGGGG + Intergenic
912427221 1:109605134-109605156 AAGCATCTGCTTACAAATGGAGG - Exonic
914736085 1:150418288-150418310 TCTCTTCTGTTTTCAAAAGCTGG + Intronic
916806322 1:168264945-168264967 CCTCATCTGTTAACAGAAGGAGG + Intergenic
917710390 1:177678704-177678726 TTTCCTGTGTTTACAAGAGGAGG + Intergenic
919047188 1:192467604-192467626 TATAATTTGATTACAACAGGAGG + Intergenic
919224255 1:194674315-194674337 TAACAACTCTTTACAAATGGAGG - Intergenic
920900094 1:210100983-210101005 TACAATCTGTTTAAAAAGGGTGG - Intronic
922623567 1:227013245-227013267 TATCATGTGTTAACAAAATCAGG + Intronic
923081456 1:230660089-230660111 TATCAGCTGTTCATAAAAGTAGG + Intronic
1063637653 10:7799089-7799111 TTTCATCTGTTTAGCAATGGAGG - Exonic
1067253077 10:44606223-44606245 TATTATCCTTTTACAAAAGCTGG - Intergenic
1069899705 10:71700520-71700542 TATCTCCTGTTTGCAAAATGGGG + Intronic
1071491385 10:86138953-86138975 TGACGTCTCTTTACAAAAGGTGG - Exonic
1072072795 10:91936167-91936189 TATCAGCTGTTTGAAAATGGAGG + Intronic
1075503338 10:122998334-122998356 TCTGATATGTTTAAAAAAGGGGG + Intronic
1077745266 11:4896388-4896410 AATCATTTGTTTACAGAGGGTGG - Intronic
1078056715 11:8015189-8015211 TATACTCTGATTCCAAAAGGTGG - Intergenic
1079164130 11:18021936-18021958 TGTCAACTTTTTAGAAAAGGGGG - Intronic
1079717544 11:23767042-23767064 TATCACCTTTTGTCAAAAGGTGG - Intergenic
1080382846 11:31791761-31791783 AATCATCATTTTACAAATGGTGG - Intronic
1084119918 11:67062944-67062966 TTTCATCTGTGTACAAAACCTGG + Intronic
1085239674 11:75042293-75042315 TATCATCTTTGAAAAAAAGGGGG + Intergenic
1086858716 11:91899071-91899093 TATCATTTTTTTTCAGAAGGTGG + Intergenic
1087283448 11:96238757-96238779 AATAATGTGTTTACAAAATGGGG + Intronic
1088950542 11:114565315-114565337 AACCATCTGTTTAAAATAGGTGG + Intergenic
1089833335 11:121348371-121348393 TCTTATCTGTTTTCACAAGGTGG - Intergenic
1090317016 11:125801649-125801671 TTTCATCTGATTAAAATAGGCGG - Intergenic
1092124649 12:6066612-6066634 TAGCATCTGTTCCCCAAAGGGGG - Intronic
1092755704 12:11761449-11761471 GATCATCTCTTTAAAAAAGATGG - Intronic
1093551533 12:20418205-20418227 TATCCCCTGCTTACAGAAGGAGG - Intronic
1097388576 12:58980929-58980951 TATAACCAGTTTTCAAAAGGGGG + Intergenic
1097714155 12:62947806-62947828 TATCATCTGTTGGTATAAGGTGG + Intergenic
1098216989 12:68231265-68231287 TCTCAACTGTTAAAAAAAGGAGG + Intergenic
1098365297 12:69697057-69697079 TATATTATGTTCACAAAAGGAGG - Intronic
1099742103 12:86651703-86651725 TATCACTTTTTTAAAAAAGGTGG + Intronic
1100775343 12:97967288-97967310 AATTATCTTTTTACTAAAGGAGG + Intergenic
1102647348 12:114412393-114412415 TCTCCCCTGTTTAAAAAAGGGGG - Intergenic
1102759047 12:115369283-115369305 TATCATCAATTTACAAGAGAGGG + Intergenic
1106657424 13:31760828-31760850 AATCATATTTTTAAAAAAGGAGG - Intronic
1107414808 13:40190536-40190558 AATCATTTGTTTCCAAAAGGGGG + Intergenic
1108230423 13:48333535-48333557 TATCATCTGTTCAGAAAATGAGG + Intronic
1108595112 13:51942752-51942774 TATAATATCTTTACCAAAGGAGG - Intronic
1109861276 13:68201837-68201859 TGTTCTCTGTTTACAAAATGAGG + Intergenic
1111117683 13:83802376-83802398 TATCTTTTGCTTACTAAAGGAGG - Intergenic
1111866548 13:93775983-93776005 AATCATGTGTTTTCCAAAGGGGG - Intronic
1113880242 13:113621309-113621331 TATCATGTATTTTCAAATGGGGG + Intronic
1114210063 14:20606587-20606609 CTTCATCAGTTAACAAAAGGAGG - Intronic
1117257328 14:53991652-53991674 TTTCATCTGTTTAGCAATGGAGG + Intergenic
1120634701 14:86937320-86937342 TATTATCTGTTTTAAAAAGAAGG - Intergenic
1121038435 14:90725893-90725915 TACCCTTTGTTTACAAAAGATGG + Intronic
1121060870 14:90908465-90908487 TATCTTCTGTTTTCACAGGGTGG - Intronic
1122126909 14:99584062-99584084 TTTCTTCTTTTTAGAAAAGGGGG + Intronic
1124607271 15:31179068-31179090 TTTCATGTATTTACAAAAGTAGG + Intergenic
1124884367 15:33671286-33671308 TATCATTTGTTTAAAGAAGAAGG + Intronic
1126717909 15:51541103-51541125 TATAATTTGTTTTCAAAATGTGG - Intronic
1127007427 15:54585955-54585977 TCTCATATCTTTATAAAAGGGGG + Intronic
1127203378 15:56684011-56684033 TATCCTCTGTTTGCAAAAACAGG + Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128672083 15:69581288-69581310 TATCATATGTTTCCAAGAAGGGG + Intergenic
1131272552 15:90956075-90956097 TTTCTTCAGTTTACAAAGGGAGG - Intronic
1132310986 15:100857994-100858016 TCTCAACTGTTCGCAAAAGGGGG + Intergenic
1140561705 16:75990150-75990172 TGTCATTTGTTTAGAAAAGTGGG - Intergenic
1142005637 16:87688386-87688408 TAACGTCTCTTTACAAACGGAGG + Intronic
1142664250 17:1453249-1453271 TCTTATCTGTTTTGAAAAGGTGG + Intronic
1143167398 17:4903743-4903765 TATCATCTGTGACCACAAGGTGG - Intergenic
1145877815 17:28333126-28333148 TATGACCTGTTTAAAAAGGGAGG + Intronic
1146080084 17:29772175-29772197 TATCCTCATTTTACAAAATGAGG + Intronic
1148062058 17:44843495-44843517 TCTTATCTGTTTACTAAAGCAGG + Intergenic
1149215360 17:54347598-54347620 TCTCATATGTTTTCTAAAGGTGG + Intergenic
1149879075 17:60269611-60269633 AATGACATGTTTACAAAAGGAGG + Intronic
1153852133 18:9104727-9104749 TACTATTTGTTTAAAAAAGGGGG - Intronic
1155679970 18:28476460-28476482 CATCATCTGTTGACCAATGGAGG + Intergenic
1155880104 18:31135752-31135774 TATTATCCTTTTACAAATGGTGG - Intronic
1156862495 18:41854479-41854501 AATTATTTGTTTGCAAAAGGAGG - Intergenic
1157637189 18:49170178-49170200 CATCATCTATTTATAAAAGGGGG - Intronic
1159000735 18:62972764-62972786 TATCCTCTGTTTAGAAAAGCAGG + Intronic
1159205566 18:65246661-65246683 TATAATGTATTTACAAATGGTGG - Intergenic
1165528443 19:36376607-36376629 TATCAACAATTTACAAAAGGAGG + Intronic
1165888665 19:39097725-39097747 TATCATGTGTGTACAATAGTTGG + Intronic
927163638 2:20294586-20294608 TATCATCAGATTATAAAAGGGGG + Intronic
927373325 2:22383132-22383154 TGTCTTCTGTGGACAAAAGGAGG + Intergenic
928375088 2:30767426-30767448 GGTCATCTGTTAACAAAATGGGG + Intronic
929266891 2:39928498-39928520 TTTCCTCTGATTAAAAAAGGGGG - Intergenic
930610592 2:53538817-53538839 TAACATCTGTTTTTAAAATGGGG + Intronic
932514706 2:72334056-72334078 TTTTGTCTGTTTAAAAAAGGGGG - Intronic
933213938 2:79604584-79604606 ACTCAGCTGATTACAAAAGGAGG - Intronic
933328536 2:80868754-80868776 TATCATCTGAGTACATAATGGGG + Intergenic
936590929 2:113803587-113803609 TATCATCTGTATAAGAAATGAGG + Intergenic
939741881 2:145917893-145917915 TTTCATTTTTTTAAAAAAGGTGG + Intergenic
940102002 2:150051185-150051207 TAAAATCTGTGTATAAAAGGAGG - Intergenic
947257893 2:228185708-228185730 TATCAACTGTTGAGAAAAAGTGG - Intergenic
1169789813 20:9397913-9397935 TGTCATCTGCTGACAAAAGCAGG - Intronic
1170002495 20:11630624-11630646 TAACATCTGATTACCAAAGAAGG + Intergenic
1172027870 20:31961550-31961572 TATCATTTGTTTTAAAATGGTGG + Intergenic
1173414229 20:42841334-42841356 TATCATCTGTGTTTTAAAGGTGG - Intronic
1173701143 20:45072993-45073015 TATTGTCTGTTTTCCAAAGGAGG + Intronic
1177225579 21:18249774-18249796 TCTTATCTGTTTTCAAAATGAGG - Intronic
1177651198 21:23964098-23964120 CCTCATCGGTTAACAAAAGGAGG + Intergenic
1183438148 22:37807342-37807364 TAACACTTGTTTAAAAAAGGGGG - Exonic
949639182 3:6015582-6015604 AAACATCTTTTTACAAAAGAAGG - Intergenic
950560567 3:13719188-13719210 TACCTTCTGTTTACAGAAGGTGG - Intergenic
954469492 3:50679933-50679955 TCTCATCTGTTTAAAAAAGAGGG - Intronic
955783894 3:62515698-62515720 TTTCCTCTGTTTAAAGAAGGGGG + Intronic
957944256 3:87042268-87042290 TATCAGAAGTTAACAAAAGGTGG + Intergenic
958021095 3:87996888-87996910 TATCTTCTCTGTACAAAATGTGG + Intergenic
958704286 3:97634392-97634414 TATCTACTGTTTATAAAATGTGG - Intronic
959864573 3:111251681-111251703 TACCATCTGTCTCTAAAAGGTGG + Intronic
961498331 3:127311062-127311084 TATCATTTTTTTTCAGAAGGTGG + Intergenic
962357714 3:134709132-134709154 TATCATCTGGTGCCAAAATGAGG - Intronic
962377947 3:134874469-134874491 TTTCTTCTATTTAAAAAAGGGGG - Intronic
962605450 3:137029104-137029126 TTTCATATGCTTTCAAAAGGTGG + Intergenic
964074714 3:152679653-152679675 TATTATCTGTTTACAAAACTTGG + Intergenic
964579713 3:158219329-158219351 TATCATCTATTCAGAAAAGGAGG - Intronic
965987630 3:174775054-174775076 TATAATCTGTTTAGAAAAATAGG + Intronic
966035253 3:175404691-175404713 TCTCAGCAGTTTACAAAAGCAGG - Intronic
966041142 3:175489970-175489992 TATCATCTGGCTAAAAACGGAGG - Intronic
966241061 3:177755819-177755841 TAAAATCTATTTAGAAAAGGGGG + Intergenic
967573804 3:191065897-191065919 TTTCATCCGTTTAAGAAAGGAGG - Intergenic
967801203 3:193662205-193662227 CATAATCTCTTTACCAAAGGAGG - Intronic
969386364 4:6851825-6851847 TTTCATCATTTTACAAAAAGAGG - Intronic
971626054 4:28921578-28921600 GATCACCAGTTTGCAAAAGGTGG - Intergenic
971659264 4:29390675-29390697 TATCAACTGATTACAAAATCAGG - Intergenic
971937389 4:33169603-33169625 TATAATCTGTTAACAAAGAGTGG - Intergenic
972790522 4:42367432-42367454 GTTCATCTGTTTACAAAATGTGG - Intergenic
974804989 4:66867462-66867484 TATCATATGTTTTCAAAAATAGG - Intergenic
975334726 4:73162530-73162552 TATCATCTGTGAACAAAATATGG + Intronic
976206640 4:82628729-82628751 TGGAATCTTTTTACAAAAGGAGG - Intergenic
978683073 4:111406278-111406300 TATGATCTGTTTTCACAACGTGG - Intergenic
979406724 4:120321095-120321117 TATCTGCTGTTTACAAAAAGAGG - Intergenic
981867210 4:149437395-149437417 CATCATCAGTTTATAAATGGTGG - Intergenic
982063398 4:151627124-151627146 TATGATCTGTTTATAAAAATAGG + Intronic
982586413 4:157246681-157246703 TATCATCTGTTGAAATAAAGGGG + Intronic
983202820 4:164880883-164880905 TAGCAACTCTTTACAAAAGTTGG + Intronic
983591897 4:169422569-169422591 TATAATCTGTTTACTAAGGTGGG - Intronic
984317229 4:178142426-178142448 CCTCATCTGTCTACAGAAGGAGG - Intergenic
984339114 4:178431180-178431202 TACCTTCTGTCTACAAAAGCCGG + Intergenic
987629289 5:20446920-20446942 TTACATCTGTTTTCTAAAGGTGG - Intronic
989814011 5:45713154-45713176 TATCTTCTTTTTCCCAAAGGAGG + Intergenic
990470645 5:56112067-56112089 GATCATCTGTTTTCAACAAGAGG + Intronic
991563940 5:67985132-67985154 TACCATTTATTTAAAAAAGGTGG + Intergenic
992658108 5:78930380-78930402 TATCTTCTTTTTAAAAAATGAGG - Intronic
994058531 5:95447372-95447394 TATCAGCTGTTTACAAACTCAGG - Intronic
995158824 5:108950880-108950902 AATCAACTGTTTACAAAAGATGG - Intronic
995882725 5:116860888-116860910 TATTATCTGTTTACTTATGGAGG + Intergenic
995968117 5:117934162-117934184 AAACATCTGTTTTTAAAAGGTGG - Intergenic
995971682 5:117979494-117979516 TGTCATCAGTTTAAAATAGGTGG - Intergenic
997807789 5:136936379-136936401 TATAATCTATTTAAATAAGGAGG + Intergenic
997890988 5:137676689-137676711 TATCCTCACTTTACAAAATGAGG + Intronic
999464216 5:151786394-151786416 AATCATATGAATACAAAAGGGGG - Intronic
1000219708 5:159201691-159201713 TAACATCTGTATAAAAAGGGGGG + Intronic
1003123901 6:3340003-3340025 TTTCATATGTTTACATAAGGAGG - Intronic
1004313027 6:14562572-14562594 CATCATCTGTGTCCCAAAGGTGG + Intergenic
1004766952 6:18740221-18740243 TATCAGCAGTGTACAAAAGCAGG - Intergenic
1006531139 6:34655449-34655471 TACCATTTGTATAAAAAAGGGGG - Intronic
1006734165 6:36260655-36260677 TACCATTTGTGTAAAAAAGGGGG - Intronic
1007011207 6:38419514-38419536 TATCATCTATTTATAAAAGAAGG + Intronic
1008484132 6:52016830-52016852 TTTTATTTGTTTAGAAAAGGGGG + Intronic
1008561202 6:52726702-52726724 TATCACCTATTTACAAACTGGGG - Intergenic
1010684481 6:78837168-78837190 TATTATATGTTTAGAAAGGGAGG - Intergenic
1010698282 6:79006139-79006161 AACCATTTGTTTACTAAAGGAGG + Intronic
1012086366 6:94830427-94830449 TATAAACTGTTTATAAAAGTTGG + Intergenic
1012134696 6:95541672-95541694 TATCATCTATTTATAAGAGTGGG - Intergenic
1012272183 6:97227045-97227067 TATTATCATTTTACAAATGGGGG - Intronic
1015423986 6:133043382-133043404 TATCATTTGTTTACAAACAATGG - Intergenic
1019665302 7:2249260-2249282 TATGATCTGTTTCCTGAAGGAGG - Intronic
1022419784 7:30209630-30209652 TCACATCACTTTACAAAAGGGGG + Intergenic
1022729189 7:33006733-33006755 TATCCTCTGTTCCCAAATGGTGG + Exonic
1024810385 7:53204228-53204250 TATCATCTATTTAGAAATGCTGG + Intergenic
1025037364 7:55604290-55604312 CATATTCTGTTTACAAAAGCTGG - Intergenic
1025044465 7:55681247-55681269 TATCCTCTGTTCCCAAATGGTGG - Intergenic
1025745902 7:64242505-64242527 TATAATCTGGTTACAAAAATTGG + Intronic
1028311952 7:89349694-89349716 TATCATGTGATTAAAAAAGGGGG + Intergenic
1028581438 7:92413472-92413494 CATCATCTTTATAAAAAAGGGGG + Intergenic
1028783166 7:94760715-94760737 AAACATCTGTTTACAAAATCAGG + Intergenic
1030605652 7:111636720-111636742 TCTCATCTCTTTATAATAGGAGG + Intergenic
1030943806 7:115690933-115690955 AATCTTCTGTTTTCAAAAGCTGG + Intergenic
1031821084 7:126502355-126502377 TAAGATCTGTTTACAGGAGGAGG + Intronic
1033929334 7:146504527-146504549 CATCATCTGTCAACAGAAGGAGG + Intronic
1036927055 8:12917162-12917184 TATAAGCTGTTCACAAAAGATGG + Intergenic
1037692472 8:21193914-21193936 TATTATTTATTTACAAAATGGGG - Intergenic
1039047139 8:33460766-33460788 TTTCACCTGTTTAAAAAAGGGGG + Intronic
1039452474 8:37686676-37686698 TCCCATTTGTTTATAAAAGGGGG + Intergenic
1039933421 8:42016641-42016663 AATCTACTGTTTAAAAAAGGGGG + Intronic
1042997216 8:74714378-74714400 TTTTATCTGTTTACAAAAGACGG + Intronic
1044194949 8:89364683-89364705 TATACTCTGTTTACAAAATTTGG - Intergenic
1045522907 8:102918695-102918717 TATTATCTGTTTAAAAAAAAAGG + Intronic
1046088938 8:109475041-109475063 TTGCACTTGTTTACAAAAGGAGG + Intronic
1048496896 8:134942931-134942953 GAGCATCTGTGGACAAAAGGTGG - Intergenic
1050032347 9:1399798-1399820 TATCATCCTTTCACAAAAAGAGG - Intergenic
1050574479 9:6979156-6979178 TGTAATCTTTTGACAAAAGGGGG - Intronic
1051467716 9:17399636-17399658 TATCATCTGTTTACAAAAGGTGG - Intronic
1051980475 9:23008890-23008912 TTTCATATGTCTACAAATGGTGG + Intergenic
1052385047 9:27812698-27812720 TATCAGCAGTGGACAAAAGGGGG - Intergenic
1054790983 9:69256487-69256509 TTTCTCCTGTTCACAAAAGGTGG - Intergenic
1054926312 9:70592172-70592194 TAGAAACTGTTTATAAAAGGAGG - Intronic
1058950698 9:109901297-109901319 TCTCAGCTGTTTACAACAGGTGG - Intronic
1186438107 X:9560826-9560848 TGTCATCTGTCGACAACAGGAGG - Intronic
1187677119 X:21727380-21727402 TATCATCTGTATCCAAAATTGGG + Intronic
1188037427 X:25334276-25334298 TATCATCTAATTTCAAAATGTGG + Intergenic
1188933015 X:36137941-36137963 TAACATCTGTTTCAAAAAAGAGG - Exonic
1189173639 X:38932817-38932839 TATCATCTGTTTAATCATGGAGG + Intergenic
1190587943 X:51965670-51965692 TGTCATCTGTTTAAAATAGTGGG - Intergenic
1192308643 X:69989889-69989911 TATCATCAGTGTCTAAAAGGAGG + Intronic
1192970459 X:76222926-76222948 TTTCATCTGTTTTAAAAAGAGGG - Intergenic
1195449002 X:104988543-104988565 TATCATGTGCTAACAAAAGACGG - Intronic
1196199080 X:112865248-112865270 TGTCATCTGTTTTAAAAAGCAGG + Intergenic
1198318639 X:135496197-135496219 TATCATCTGTTTTCTAGAGATGG + Intergenic
1199849133 X:151712751-151712773 TATCATCTTTTTCCCTAAGGGGG - Intergenic
1200754469 Y:6977300-6977322 TGTCATCTGTCAACAACAGGAGG - Intronic
1202332286 Y:23767451-23767473 TTTCATCTGTTTTCTAAAGCAGG - Intergenic
1202538483 Y:25902612-25902634 TTTCATCTGTTTTCTAAAGCAGG + Intergenic