ID: 1051469679

View in Genome Browser
Species Human (GRCh38)
Location 9:17423610-17423632
Sequence CTGCGGTCCTTGGGCAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051469679_1051469684 16 Left 1051469679 9:17423610-17423632 CCAGACTTGCCCAAGGACCGCAG 0: 1
1: 0
2: 3
3: 8
4: 97
Right 1051469684 9:17423649-17423671 TCATATTTATTCAGTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051469679 Original CRISPR CTGCGGTCCTTGGGCAAGTC TGG (reversed) Intronic
900243710 1:1628413-1628435 CCCCGGTCCTTGGGCAGGACTGG - Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900371797 1:2335522-2335544 CCGGGGGCCTTGGGCAAGGCAGG - Intronic
900582088 1:3414377-3414399 CTGTGGGCCTTGGGGATGTCGGG - Intronic
900733292 1:4277431-4277453 CTGAGCTCCTGAGGCAAGTCAGG + Intergenic
901789822 1:11648250-11648272 CAGCGGACCTTGGGCCAGTATGG - Intergenic
902438974 1:16416856-16416878 CTGCGGTCCCTCAGCAAGTGCGG + Intronic
903679374 1:25087137-25087159 CTGTGGTCCTTGGCCTTGTCTGG - Intergenic
904292261 1:29495524-29495546 CTGGGGTCCTTGGAGAAATCTGG - Intergenic
905403382 1:37718302-37718324 CCACGGTCCTTGGGCAGGGCTGG + Exonic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
911883043 1:103265863-103265885 CTGCAGTCATTGAGGAAGTCAGG - Intergenic
912952999 1:114133574-114133596 CAGGGGCCCTTGGGCAAGCCAGG + Intronic
914195434 1:145445930-145445952 CTGCTGTCCTCAGGCAAGTGGGG - Intergenic
916262804 1:162859548-162859570 CTGCAGTCTTTGGTCCAGTCTGG + Exonic
920432580 1:205928261-205928283 CCGGGGACCTTGGGCAAGTTAGG - Intronic
924386730 1:243506167-243506189 CTGCGGTCCTTGGGCCTGACGGG - Intronic
1066196229 10:33102836-33102858 CTGCAGTCCTCAGGCAAATCTGG + Intergenic
1070279291 10:75037183-75037205 CTGCGTCCCTTGGGAAAGTGGGG + Intergenic
1073061292 10:100735376-100735398 CTGCGGTCCGTGGGCGCCTCAGG + Intergenic
1075738249 10:124677436-124677458 CTGCGATCCCTGCGCAAGCCCGG - Intronic
1075828591 10:125383489-125383511 CTTAGGTACTTAGGCAAGTCTGG + Intergenic
1076500071 10:130930127-130930149 CTGTGTCCCTTGGGCAAGGCTGG - Intergenic
1080172528 11:29322449-29322471 CTGTGGTCCTTGCTCAACTCTGG + Intergenic
1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG + Intronic
1083804596 11:65066411-65066433 CTGTGGTCGTGGGGCAGGTCAGG + Intronic
1084608801 11:70187780-70187802 CTGATGTCCTTGGGGATGTCCGG - Exonic
1085235400 11:75010597-75010619 CTGTGATCCTTGGGAAAGCCAGG - Exonic
1085508443 11:77073301-77073323 CTGCAGGCCTTGGGCAGGACAGG - Intronic
1089557051 11:119320601-119320623 CTGCGGTCCCTGGGAAAGCCAGG - Intronic
1089588661 11:119525973-119525995 CTGGGCTCCTTGAGCAAGCCAGG + Intergenic
1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG + Intronic
1092138565 12:6167077-6167099 CTTCGGTTCTTGGTCAAGTGAGG - Intergenic
1092708246 12:11308251-11308273 CTGTTGTCCCTGGGCAGGTCTGG + Exonic
1096478815 12:51924557-51924579 CTGGGGTCCCTGAGGAAGTCAGG - Intergenic
1102256502 12:111418482-111418504 CTGCGGGCCTTGGGCAGGCCAGG - Exonic
1110416029 13:75253660-75253682 CTGGGGTTCTTGAGCAATTCAGG + Intergenic
1119175341 14:72564507-72564529 CGGGGATCCTTGGGCAAGGCTGG - Intronic
1121720347 14:96104753-96104775 CTCCCGTGGTTGGGCAAGTCTGG - Intergenic
1125538915 15:40458744-40458766 CTGGGGGGCTTGGGCAGGTCAGG - Exonic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1127296183 15:57610560-57610582 CTGTGGTGGTTGGGCCAGTCAGG + Intronic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1127531767 15:59850384-59850406 CGGTGGTCCTTGGGCATCTCGGG + Intergenic
1128235653 15:66065569-66065591 CCGTGGTCCTTGGGCAGGTGGGG + Intronic
1128732765 15:70032571-70032593 CTGTGGTCCTGGGGCAGGGCTGG - Intergenic
1129853175 15:78806698-78806720 CTGTGATCCTTGGGAAAGTTAGG - Intronic
1132223479 15:100123075-100123097 GTGGGGTCCTTGGGAAAGTTGGG - Intronic
1136536666 16:30903635-30903657 CTGGGCTTCTTGGGCATGTCTGG - Intergenic
1141667957 16:85475597-85475619 CTGCAGTGCCTGGGCAATTCTGG + Intergenic
1145311755 17:21704684-21704706 CTGCAGTCCCTGGGCAAGCAGGG + Intergenic
1148047054 17:44750699-44750721 CTGGAGCCCTTGGGCAAGGCCGG - Exonic
1152031755 17:77847229-77847251 CTGAGTTCCTTGGGCAAGCTGGG - Intergenic
1152834476 17:82520225-82520247 CTGCGCTGCTTGGGCAAGAACGG + Exonic
1160581028 18:79884679-79884701 CTGTGGGCCTTGGGCGTGTCCGG - Intronic
1161963222 19:7534227-7534249 CTGCGGCCCCTGGGTGAGTCTGG + Exonic
1163145872 19:15379210-15379232 CCGCGGGCCTAGGGCAGGTCGGG + Intronic
1163536447 19:17879550-17879572 CTGAGGTCAATGGGCAAGTCGGG + Intronic
1163777015 19:19224745-19224767 CTCAGGCCCATGGGCAAGTCGGG - Intronic
1164461702 19:28454588-28454610 CTGGGGTCCCTGGGGAGGTCCGG - Intergenic
1168423065 19:56217724-56217746 CTGCAGTCCTTGGGGAAGCGGGG + Intergenic
926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG + Intergenic
931416213 2:62083443-62083465 CTTCAGCCCATGGGCAAGTCTGG - Intronic
1170505091 20:17017320-17017342 CTGGGGTCCATGGTGAAGTCAGG + Intergenic
1171024182 20:21613849-21613871 ATGCGATCCCTGGGGAAGTCAGG + Intergenic
1173836217 20:46127990-46128012 CCGCGGTCCTTGGGGAAATGTGG - Intronic
1175973138 20:62697203-62697225 CTGTGGACCTTGGGCCAGGCTGG + Intergenic
1177009607 21:15716095-15716117 CTGCAGTCCTTGGGGATGTATGG + Intergenic
1177927983 21:27242737-27242759 CTCCTGTCCTTGGACAAATCTGG + Intergenic
1179999996 21:44991234-44991256 CAGCTGTGCTGGGGCAAGTCTGG + Intergenic
1181493978 22:23277672-23277694 CTGCTGAGCCTGGGCAAGTCTGG + Intronic
1181963254 22:26638295-26638317 CTCAGGTCCTTGGGCAAAGCGGG + Intergenic
1183478425 22:38049923-38049945 CTACGGTCTTTAGGCCAGTCTGG + Intergenic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
961957015 3:130814929-130814951 GTGCGGTGCTTGGGCATGGCAGG + Intergenic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG + Intronic
973729020 4:53805249-53805271 CTCAAGTCCATGGGCAAGTCTGG - Intronic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
975699392 4:77048472-77048494 CTGTTGTCCTTGGAGAAGTCTGG + Exonic
976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG + Intergenic
977150853 4:93509729-93509751 CTGGGGTGCTTGGGTAAGGCAGG - Intronic
983661703 4:170135717-170135739 CAGGGGTCCTCGGGGAAGTCAGG - Intergenic
988845511 5:35123652-35123674 CCGTGGTCCTTGGAAAAGTCAGG + Intronic
990016832 5:51073453-51073475 CTGGGGTCCATGGTAAAGTCTGG + Intergenic
990326079 5:54676634-54676656 GTGCTGTACTTGGGCAACTCAGG - Intergenic
998050315 5:139026983-139027005 CTGCTCTCCTTAGGCAAGGCAGG - Exonic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1000539241 5:162519872-162519894 CTGTGGACTTTGGGCAAGACAGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1013274314 6:108569713-108569735 CTGCAGTCCTAGGGCACATCTGG - Intronic
1023922371 7:44639411-44639433 CTCTGGTACTTGGGCAGGTCTGG + Intronic
1028033562 7:85950016-85950038 CTACAGTCCTTGGGCAAGTATGG - Intergenic
1034048521 7:147956608-147956630 CTGCGGTCCATGGTCATTTCAGG - Intronic
1045488365 8:102651809-102651831 CTGCTTTCATTGGGCAGGTCTGG + Exonic
1047799944 8:128298447-128298469 GTGGGGTCCTTGGGCAGGGCAGG + Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1055802302 9:80051963-80051985 CTGGGGTCCATGGTAAAGTCAGG - Intergenic
1057449445 9:95143759-95143781 CTGAGGTCCTTTTGTAAGTCTGG - Intronic
1059041434 9:110819402-110819424 CTGGGGTCCTTGGACAATTGAGG + Intergenic
1059350858 9:113663794-113663816 CTGTGGTCCTGGGACAAGGCAGG - Intergenic
1060186808 9:121568601-121568623 ATGCGGTCCTTGGGGAGGCCAGG + Intronic
1061965142 9:134009435-134009457 CTGATATCCTTGAGCAAGTCAGG + Intergenic
1062699230 9:137890420-137890442 CTGCTGTCCTCAGGCAAGTGGGG + Intronic
1187790723 X:22947189-22947211 CTGCTTTCCTTGGTCAAGACTGG + Intergenic
1190979355 X:55442299-55442321 CTGGGGTCCTTTGGCATCTCAGG - Intergenic
1195825014 X:108990305-108990327 CTGTAGTTTTTGGGCAAGTCTGG - Intergenic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic
1201467115 Y:14294760-14294782 TTGAGGTCCTTGGGGTAGTCAGG + Intergenic