ID: 1051470564

View in Genome Browser
Species Human (GRCh38)
Location 9:17435861-17435883
Sequence CCGTAAAAAAGGAGCTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051470564_1051470568 4 Left 1051470564 9:17435861-17435883 CCAGGGTAGCTCCTTTTTTACGG 0: 1
1: 0
2: 1
3: 3
4: 47
Right 1051470568 9:17435888-17435910 ACTTCCCATCTGACCTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051470564 Original CRISPR CCGTAAAAAAGGAGCTACCC TGG (reversed) Intronic
908263445 1:62356374-62356396 CAGTAAGAAAGTAGCTAACCAGG + Intergenic
910195242 1:84633434-84633456 CAGTATAAAAGGAGACACCCAGG - Intronic
917346449 1:174033176-174033198 CTGAAAAAAGGGAGCTACTCTGG - Intergenic
1065361635 10:24894646-24894668 CCTCAAAAATGGAGCTGCCCTGG - Intronic
1069468507 10:68664130-68664152 ACAGTAAAAAGGAGCTACCCAGG - Intronic
1080790901 11:35521646-35521668 CAGTAAAACAGGAGCTAGCAAGG + Intronic
1087976554 11:104556812-104556834 CCTTTATAAAGAAGCTACCCTGG + Intergenic
1092703003 12:11254025-11254047 CCTCAAAAAAGGAGCTGCCTTGG + Intergenic
1097536218 12:60873317-60873339 CCGGGACAAAGGAGCTTCCCGGG + Intergenic
1107747947 13:43532400-43532422 CCATAAAAAAGGATCTATCAGGG - Intronic
1109993795 13:70095014-70095036 CTGTAAAAAGAGAGATACCCAGG - Intronic
1110924411 13:81132123-81132145 CCATAACAAAGGGGCTACACAGG - Intergenic
1116201799 14:41806843-41806865 CCATAAAAAAGGAGCTGTCCAGG - Intronic
1118872158 14:69752503-69752525 CTGTTAAAAAGGAGATACCTGGG + Intronic
1121353783 14:93196022-93196044 CCATAAAAAAGGAGCCACCTTGG - Intronic
1132384289 15:101389251-101389273 CCGTTAAACAGCAGCTGCCCAGG - Intronic
1144786673 17:17836110-17836132 CCCTAAAAGAGGGGGTACCCAGG + Intronic
1148958633 17:51374604-51374626 CCAGAAAAAAGGAGCTGTCCAGG - Intergenic
1159486363 18:69063364-69063386 CAGAAAAAAAGGAACTACCTAGG + Intergenic
1166344293 19:42155812-42155834 CAGAAAAAAAGGAGCTGACCAGG + Intronic
928133019 2:28667056-28667078 CCTCAAAAAAGGAGCTACCCAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
937496804 2:122429155-122429177 CCAACAAAAAGGAGCCACCCTGG + Intergenic
942937306 2:181573813-181573835 TCACAAAAAAGAAGCTACCCAGG - Exonic
943748985 2:191491429-191491451 CCATAAAAAAGGAGTTAACAAGG + Intergenic
945008532 2:205436716-205436738 CCGTAGAAAAGAAGCCACCAGGG - Intronic
945065252 2:205942839-205942861 TTTTAAAAAAAGAGCTACCCAGG + Intergenic
1172939215 20:38643360-38643382 CCAGAAAGAAGGAGCTATCCTGG + Intronic
1172942498 20:38664088-38664110 CAGGTAAAAAGGAGATACCCTGG - Intergenic
1181524329 22:23470807-23470829 CTGTAAAAAAGATGCTACCAAGG - Intergenic
1181659545 22:24333793-24333815 CAGTAAAAAAGGAGGTAGACTGG - Intronic
949399337 3:3649185-3649207 CCATAAATCAGTAGCTACCCAGG - Intergenic
950830426 3:15869666-15869688 CCTTAAAAAAGGAGGAATCCTGG + Intergenic
961409959 3:126713230-126713252 CAGTTAAAAAGGAGTTGCCCGGG + Intronic
963854440 3:150239154-150239176 CAGGAAGAAAGGAGTTACCCAGG + Intergenic
967538129 3:190631347-190631369 CTGTAAAAGGGGAGCTACTCTGG - Intronic
969515704 4:7647066-7647088 CCGAAAAACAGGAGGTAGCCAGG + Intronic
1007907903 6:45482114-45482136 CAGGAAAAAAAGAGCTAACCGGG - Intronic
1008956764 6:57224138-57224160 CCTTAAAAAAGGAGGGACCCAGG + Intergenic
1011022392 6:82828973-82828995 CAGTAAAAATGGAGTTACTCTGG + Intergenic
1022656285 7:32322441-32322463 ACGTAAAAAAGAAGTTAGCCAGG + Intergenic
1023211032 7:37804969-37804991 CAGTAGGAAAGGAGCTACCTGGG + Intronic
1024757993 7:52559237-52559259 CCTGAAAAAAAGAGCTACCTGGG - Intergenic
1026937150 7:74264120-74264142 CCCTAAAAATGGAGCTGTCCAGG - Intergenic
1039150572 8:34500477-34500499 CCATAAAAAAAGACCTTCCCAGG - Intergenic
1040059770 8:43093915-43093937 CCGTAAAAAAGCACTTAGCCGGG + Intronic
1045714535 8:105026217-105026239 CCGTAACAAAGGAGGTTACCTGG - Intronic
1048157191 8:131968345-131968367 TCGTAAAAAAGATGCTCCCCGGG + Exonic
1051136062 9:13922875-13922897 CCTTAAAAAAGGAAAGACCCTGG + Intergenic
1051470564 9:17435861-17435883 CCGTAAAAAAGGAGCTACCCTGG - Intronic
1196279158 X:113802536-113802558 CCGTAAAAAGAGAGAAACCCTGG - Intergenic
1199737936 X:150702284-150702306 CTGTAAAAATGCAGCTTCCCGGG + Intronic