ID: 1051472038

View in Genome Browser
Species Human (GRCh38)
Location 9:17454703-17454725
Sequence ACCTAACAAAGGTGATCTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051472038_1051472040 6 Left 1051472038 9:17454703-17454725 CCTCGAGATCACCTTTGTTAGGT 0: 1
1: 0
2: 0
3: 18
4: 185
Right 1051472040 9:17454732-17454754 GCACCATCTCTTTTTAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051472038 Original CRISPR ACCTAACAAAGGTGATCTCG AGG (reversed) Intronic
904155305 1:28478101-28478123 AGCTAAAAAAGTTGATCTCATGG - Intronic
906284134 1:44575224-44575246 AGCTAAAAAAGTTGATCTCATGG - Intronic
906361114 1:45160479-45160501 AGCTAAAAAAGTTGATCTCATGG - Intronic
906369921 1:45244589-45244611 ATCTAAAAAAGTTGATCTCATGG + Intronic
906510975 1:46410392-46410414 TCCCAGCAAAGGTGATTTCGTGG + Exonic
906755016 1:48303476-48303498 AGCTAAAAAAGTTGATCTCATGG - Intronic
908800044 1:67870694-67870716 AGCTAAAAAAGTGGATCTCGTGG + Intergenic
909555144 1:76945158-76945180 ACCTAACAAAAGGCATCTAGAGG + Intronic
910058103 1:83055952-83055974 ACCTAACAAAGGTGAATTTGGGG - Intergenic
910912308 1:92249826-92249848 AGCTAACAAACTTGATCTCGTGG - Intronic
912857748 1:113186523-113186545 AGCTAAAAAAGTTGATCTCATGG + Intergenic
917001161 1:170361505-170361527 AACTAAAAAAGTTGATCTCATGG - Intergenic
917261029 1:173169684-173169706 AGCTAAAAAAGTTGATCTCATGG + Intergenic
917891854 1:179447264-179447286 ACCTAAAAAATTTGATCTTGTGG - Intronic
919173915 1:193995022-193995044 ATCTAAAACAGTTGATCTCGTGG + Intergenic
921346430 1:214190294-214190316 AGCTAAAAAAGTTGATCTCGTGG - Intergenic
924025183 1:239824803-239824825 TCCTAACCAAGGAGATCTAGTGG + Intronic
924669607 1:246110317-246110339 ACCTAACAATGGGGATCTTAGGG - Intronic
924888732 1:248250379-248250401 AACTAAAAAAGATGATCTCATGG + Intergenic
924931376 1:248735614-248735636 AGCTAACAAAGTTTATCTCATGG + Intronic
1063076998 10:2727250-2727272 AACTAAAAAAGTTGATCTCGTGG - Intergenic
1064780320 10:18830550-18830572 AGCTAAGAAAGTTGATCTCATGG + Intergenic
1065448904 10:25834144-25834166 AGCTAAGAAAGTTGATCTCATGG - Intergenic
1066283493 10:33941258-33941280 AGCTAAGAAAGTTGATCTCATGG - Intergenic
1067203814 10:44196955-44196977 ATCTAACAAAGTTGATCTCATGG - Intergenic
1068557893 10:58479472-58479494 AGCTAAAAAAGTTGATCTCATGG + Intergenic
1068616051 10:59118336-59118358 ATCTAACAAAGTTGAACTCATGG - Intergenic
1068795663 10:61076845-61076867 AGCTAAAAAAGTTGATCTCATGG - Intergenic
1070375623 10:75828479-75828501 ACCACACAAATGTGATCTTGGGG + Intronic
1070663169 10:78322513-78322535 AGCTAAAAAAGTTGATCTCATGG - Intergenic
1072381148 10:94871890-94871912 AACTAAAAAAGTTGATCTCATGG + Intergenic
1078490435 11:11763016-11763038 ACATAGCAAATGTCATCTCGGGG + Intergenic
1079148855 11:17879420-17879442 TCATAACATAGGTGATCTCCAGG - Intronic
1079834174 11:25310675-25310697 ATCTAAAAAAGTTGATCTCATGG + Intergenic
1083121287 11:60515084-60515106 ACCTTCCAAAGGTGCTCTTGTGG + Intergenic
1086470642 11:87105976-87105998 AGCTAAAAAAGTTGATCTCCTGG - Intronic
1087874197 11:103336508-103336530 AGCTAAAAAAGTTGATCTCATGG - Intronic
1088000183 11:104869917-104869939 ACCTAACAAAAATGTTCTCCAGG - Intergenic
1088187356 11:107186131-107186153 ATCTAAAAAAGTTGATCTCATGG - Intergenic
1090140967 11:124261025-124261047 AGCTAAAAAAGCTGATCTCATGG - Intergenic
1090543796 11:127738934-127738956 ACCAAACAAAGCTGAGCTGGTGG - Intergenic
1091598365 12:1897163-1897185 AGCTAAAAAAGTTGATCTCATGG + Intronic
1093251944 12:16816814-16816836 ACCTAGAAAAGGTGAACTCATGG + Intergenic
1093430593 12:19080804-19080826 AGCTAACAAAGGTGAGCTCATGG - Intergenic
1095281553 12:40357140-40357162 AGCTAAAAAAGTTGATCTCATGG - Intronic
1095288365 12:40444100-40444122 AAATAACAATGGTGATCTCAAGG + Exonic
1095900448 12:47322327-47322349 AGCTAAAAAAGTTGATCTCATGG + Intergenic
1098054036 12:66484615-66484637 AGCTAAAAAAGTTGATCTCGTGG + Intronic
1103004628 12:117411086-117411108 AGCTAAAAAAGTTGATCTTGTGG - Intronic
1103641047 12:122352725-122352747 AATTACCAAAGGTGATCTTGAGG - Exonic
1106073763 13:26439714-26439736 AACTAAAAAAGCTGATCTCATGG + Intergenic
1108674852 13:52727736-52727758 AGCTAAAAAAGTTGATCTCATGG + Intronic
1109458282 13:62623094-62623116 AACTAAAAAAGTTGATCTCATGG + Intergenic
1111053387 13:82915822-82915844 ATCTAAAAAAGTTGATCTTGTGG + Intergenic
1114698759 14:24654678-24654700 AGCTAAAAAAGTTGATCTCATGG - Intergenic
1115792816 14:36898703-36898725 ACCTAAAACAGCTGATCTCATGG + Intronic
1118141040 14:63083093-63083115 AGCTAAAAAAGTTGATCTCATGG + Intronic
1119811529 14:77524790-77524812 AGCTAAAAAAGTTGATCTCATGG + Intronic
1122149093 14:99714941-99714963 AGCTAAAAAAGTTGATCTCATGG + Intronic
1124203843 15:27700691-27700713 AGCTAAAAAAGTTGATCTCCTGG - Intergenic
1124702863 15:31931984-31932006 ACCTAAAAAAACTGATCTCATGG - Intergenic
1124915660 15:33970121-33970143 ACCTAACTACGGAGATCTTGTGG + Intronic
1126528210 15:49682158-49682180 AGCTTAAAAAGGTGATCTCATGG + Intergenic
1129963021 15:79705922-79705944 AGCTAAAAAAGTTGATCTCATGG - Intergenic
1135090575 16:19511765-19511787 AGCTAAAAAAGTTGATCTCATGG - Intronic
1138086348 16:54137096-54137118 AGCTAAAAAAGTTGATCTCGTGG - Intergenic
1139160461 16:64501098-64501120 AGCTAACAAAGTTGATCTCATGG - Intergenic
1143892101 17:10110334-10110356 AGCTAAAAAAGTTGCTCTCGTGG + Intronic
1144076526 17:11724380-11724402 AGCTAAAAAAGTTGATCTCATGG - Intronic
1149075152 17:52587795-52587817 AGCTAAAAAAGTTGATCTCATGG - Intergenic
1149125327 17:53223520-53223542 AACTAAAAAAGTTGATCTCACGG + Intergenic
1149877108 17:60246224-60246246 AGCTAAAAAAGTTGATCTCGTGG - Intronic
1150812651 17:68368824-68368846 ACCTATGAAAGGGGATCACGGGG - Intronic
1150908122 17:69360469-69360491 AGCTAAAAAAGTTGATCTCATGG + Intergenic
1153729699 18:7998317-7998339 AGCTAAAAAAGTTGATCTCATGG + Intronic
1157445237 18:47740130-47740152 AGCTAAGAAAGTTGATCTCATGG + Intergenic
1157749282 18:50163647-50163669 CCCTAACAAAGGTAGTCTCTGGG + Intronic
1158583921 18:58712489-58712511 AGCTAAAAAAGTTGATCTCATGG + Intronic
1159008238 18:63033040-63033062 ACCTAAAAAAGTTGATTTCATGG + Intergenic
1160154100 18:76419997-76420019 ACCTCACACAGGTGATCATGAGG + Intronic
925255958 2:2488279-2488301 AGCTAAAAAAGGTGAACTCCTGG - Intergenic
926025818 2:9543707-9543729 AGCTAAAAAAGTGGATCTCGTGG + Intronic
927117033 2:19915832-19915854 ATCTAAAAAAGTTGACCTCGTGG + Intronic
927837936 2:26416030-26416052 ACCTAACTAAGGAGTGCTCGGGG - Intronic
928067528 2:28181410-28181432 AGCTAACAAAGTTAATCTCATGG + Intronic
928142400 2:28741216-28741238 AGCTAAAAAAGTTGATCTCAGGG + Intergenic
929207198 2:39310300-39310322 AGCTAAAAAAGTTGATCTCATGG - Intronic
932859019 2:75269137-75269159 AGCTAAAAAAGTTGATCTCATGG - Intergenic
933258384 2:80106079-80106101 CCCTAACAAAGGTGAACACAGGG + Intronic
937037357 2:118793176-118793198 GCCTAACAGAAGTGATCTCCTGG + Intergenic
938705894 2:133926281-133926303 AGCTAAAAAAGTTGATCTCATGG + Intergenic
940763101 2:157760228-157760250 AGCTAAAAAAGTTGATCTCATGG + Intronic
941198536 2:162480393-162480415 ACCTAAGGAAGGTGAACTTGTGG + Intronic
941846266 2:170137103-170137125 AGCTAAAAAAGTTGATCTCATGG + Intergenic
942328515 2:174796368-174796390 GCCTCACAAAGGTTATCTCTGGG - Intergenic
943880523 2:193139286-193139308 ACCTAAAAAAGTTGATGTCATGG + Intergenic
945789570 2:214288125-214288147 AGCTAAAAAAGTTGATCTCATGG - Intronic
1169607895 20:7343497-7343519 AGCTAAGAAAGTTGATCTCATGG + Intergenic
1169837277 20:9894383-9894405 AGCTAAAAAAGTTGATCTCATGG + Intergenic
1172088030 20:32404214-32404236 AGCTAAAAGAGTTGATCTCGTGG - Intronic
1173199134 20:40941386-40941408 TCCTAACAAAGGAGATCTGAAGG - Intergenic
1173316270 20:41947093-41947115 AACTAAAAAAGTTGATCTCACGG - Intergenic
1177540480 21:22487037-22487059 AGCTAAAAAAGGTGATCTCATGG - Intergenic
951425497 3:22539987-22540009 ACCTAACAAATGTGATAGTGAGG + Intergenic
954569906 3:51632029-51632051 AACTAAAAAAGTTGATCTCATGG - Intronic
954842344 3:53522967-53522989 AACTAAAAAAGCTGATCTCATGG - Intronic
957170115 3:76727680-76727702 AGCTAAAAAAGTTGATCTCAGGG + Intronic
959636778 3:108583530-108583552 AGCTAAAAAAGTTGATCTCATGG + Intronic
959760253 3:109954237-109954259 ATCTAAGAAAGTTGATCTCATGG - Intergenic
959913522 3:111792028-111792050 AGCTAAAAAAGTTGATCTCATGG - Intronic
961161367 3:124729469-124729491 AGCTAAAAAAGTTGATCTCATGG - Intergenic
965284217 3:166796522-166796544 AACTTAAAAAGGTGATCTCAAGG + Intergenic
966100385 3:176262042-176262064 ATCTAAAAAAGATGATCTCCTGG - Intergenic
967366251 3:188689511-188689533 ATCTAAAAAAGTTGATCTCATGG - Intronic
968311819 3:197690004-197690026 AGCTAAAAAAGTTGATCTCATGG - Intronic
971800243 4:31280255-31280277 AGCTAAGAAAGTTGATCTTGTGG - Intergenic
973984973 4:56341778-56341800 AGCTAAAAAAGTTGATCTCAGGG + Intronic
975621201 4:76298683-76298705 AGCTAAAAAAGTTGACCTCGTGG + Intronic
976750238 4:88445700-88445722 ATATAACAAACGTGATCTGGAGG + Intergenic
977417845 4:96757775-96757797 AGCTAACAAAGTAGATCACGTGG - Intergenic
977943305 4:102881225-102881247 AACTAAAAAAGTTGATCTCATGG + Intronic
978095831 4:104776099-104776121 AGCTAAAAAAGTTGATCTCATGG - Intergenic
979489198 4:121306046-121306068 AACTAAAAAAGTTGATCTCTTGG + Intergenic
980030548 4:127824748-127824770 ACCTAAAAAAGGAGATTTTGTGG - Intronic
981577430 4:146219747-146219769 ACTTAACAAAGGTTACCTCTGGG - Intergenic
982866874 4:160524730-160524752 ACCTAGGAAAGGAGACCTCGAGG + Intergenic
984539281 4:181017491-181017513 ACCTATCAAAAGTGATCTTTTGG - Intergenic
987241236 5:16002080-16002102 AGCTAAAAAAGTTGATCTCATGG - Intergenic
987630368 5:20462296-20462318 AGCTTAAAAAGTTGATCTCGTGG + Intronic
989348976 5:40462909-40462931 AGCTAAAAAAGTTGATCTCATGG + Intergenic
990461041 5:56031404-56031426 AGCTAAAAAAGTTGATCTCATGG + Intergenic
992545027 5:77805452-77805474 AGCTAAAAAAGTTGATCTCATGG - Intronic
993340974 5:86724801-86724823 AGCTAACAAAGTTAATCTCAAGG - Intergenic
993470097 5:88296854-88296876 AGCTAAGAAAGTTGATCTCATGG + Intergenic
994440951 5:99801846-99801868 AGCTAAAAAAGTTGATCTCATGG - Intergenic
997785464 5:136708063-136708085 ACCTAAAAAAGTTGATCTCATGG + Intergenic
998894563 5:146785816-146785838 AGCTAAAAAAGTTGATCTCATGG + Intronic
999346570 5:150827072-150827094 ATCTAAAAAAGTTGATCTCGTGG + Intergenic
999910454 5:156192410-156192432 AGCTAAAAAAGTTGATCTCATGG + Intronic
1000572446 5:162931714-162931736 AGCTAACAAAGTTGGTCTCATGG - Intergenic
1001092900 5:168754426-168754448 AGCTAAAAAAGTTGATCTCATGG + Intronic
1001969472 5:175943033-175943055 AGCTAAAAAAGTTAATCTCGTGG + Intronic
1002247963 5:177900720-177900742 AGCTAAAAAAGTTAATCTCGTGG - Intergenic
1004676554 6:17848453-17848475 AGCTAAAAAAGTTGATCTCATGG - Intronic
1005429541 6:25740957-25740979 AGCTAAAAAAGTTGATCTCATGG + Intergenic
1005597138 6:27389998-27390020 TCCTACCAAAGGTGATCTTCAGG - Intronic
1005776110 6:29132151-29132173 ACCTAAAAAAGTTGATCTCATGG + Intergenic
1007344846 6:41221835-41221857 ACCTAGCAAATGTGGTCTGGTGG + Intergenic
1008891893 6:56503672-56503694 ATCTAAGAAAGGTGATCTCTAGG + Intronic
1010762731 6:79742793-79742815 AGCTAAAAAAATTGATCTCGTGG - Intergenic
1013214301 6:108013552-108013574 AGCTAAAAAAGTTGATCTCATGG + Intergenic
1017143653 6:151214660-151214682 AGCTAAAAAACTTGATCTCGTGG + Intergenic
1017239992 6:152157364-152157386 AGCTAAAAAAGTTGATCTCATGG + Intronic
1017357679 6:153528824-153528846 ATCTAACCAAGGTCATCTCTTGG - Intergenic
1017427366 6:154336457-154336479 AGCTAAAAAAGTTGATCTCGTGG + Intronic
1018016574 6:159717763-159717785 AGCTAAAAAAGTTGATCTCATGG - Intronic
1019830795 7:3327477-3327499 ACCTGACAAAGATCATCTCAGGG - Intronic
1019932697 7:4234366-4234388 ATCTAACACGGGTGCTCTCGGGG - Intronic
1020053198 7:5097021-5097043 AGCTAAAAATGTTGATCTCGTGG - Intergenic
1023102097 7:36728218-36728240 AACTAAAGAAGGTGATCTCAAGG - Intergenic
1023638982 7:42238740-42238762 ACTTAAAAAAGGAGTTCTCGGGG + Intergenic
1023749458 7:43357502-43357524 AGCTAACAAAGTGGATCTCATGG + Intronic
1026299907 7:69088912-69088934 CCCTAACAAAGGTGAACACAGGG + Intergenic
1026533956 7:71224607-71224629 CCCTAGAAAAGGTGTTCTCGTGG - Intronic
1029837806 7:103331559-103331581 AGCTTAAAAAGTTGATCTCGTGG - Intronic
1031263429 7:119551666-119551688 ACCTAAAAAAATTGATCTCATGG + Intergenic
1034738185 7:153448403-153448425 AGCTAAAAAAGTTGATCTCAAGG - Intergenic
1039494567 8:37971158-37971180 ACAGAACAAAGGTCATCTGGGGG - Intergenic
1040631322 8:49215853-49215875 AGCTAAAAAAGTTGATCTCATGG - Intergenic
1040972271 8:53148911-53148933 ACTTAACAACTGTGATCTCGAGG - Intergenic
1042713042 8:71740788-71740810 CCGTAGCAAAGGTGATCTCTGGG + Intergenic
1042903761 8:73752803-73752825 AGCTAAAAAAGCTGATCTCATGG + Intronic
1045891333 8:107161400-107161422 AGCTAACAAAGTGGATCTCATGG - Intergenic
1046306796 8:112378600-112378622 AGCTAAAAAAGTTGATCTCATGG + Intronic
1046430984 8:114127255-114127277 AGCCAAAAAAGTTGATCTCGTGG - Intergenic
1047547238 8:125830401-125830423 AGCTAAAAAAGTTGATCTCATGG - Intergenic
1047673710 8:127176300-127176322 AGCTAAAAAAGCTGATCTCATGG + Intergenic
1049712623 8:144072608-144072630 AGCTAAAAAAGTTGATCTTGCGG - Intergenic
1050150143 9:2611685-2611707 AGCTAAAAAAGTTGATCTCATGG - Intergenic
1051197870 9:14583363-14583385 AGCTAAAAAAGTTGATCTCATGG + Intergenic
1051472038 9:17454703-17454725 ACCTAACAAAGGTGATCTCGAGG - Intronic
1053107430 9:35423619-35423641 ATCTAAAAAAGCTGATCTCATGG + Intergenic
1053895511 9:42737975-42737997 AACTAACAAAGGAGATCAAGTGG + Intergenic
1054908523 9:70431921-70431943 AGCTAAAAAAGTTGATCTCATGG - Intergenic
1055310538 9:74974943-74974965 AGCTAAGAAAGTTGATCTCAGGG + Intergenic
1055660906 9:78503020-78503042 ACCTAAGCAAGGTGAACCCGGGG - Intergenic
1055908681 9:81322475-81322497 AGCTAAAAAAGTTGATCTCATGG - Intergenic
1056999515 9:91494517-91494539 AGCTAACAAAGTTGATTTCATGG - Intergenic
1058145831 9:101410270-101410292 ACCTAACAAAGGTGTTACCAAGG + Exonic
1058198240 9:102006137-102006159 ATCTAAAAAAGTTGATCTCATGG - Intergenic
1061749515 9:132767894-132767916 AGCTAAAAAAGTTGATCTCATGG + Intronic
1187487014 X:19713863-19713885 AGCTAAAAAGGTTGATCTCGTGG - Intronic
1189627221 X:42911822-42911844 AGCTAAAAAAGTTGATCTCATGG + Intergenic
1189870685 X:45380116-45380138 AGCTAAAAAAGTTGATCTCATGG - Intergenic
1190805560 X:53833021-53833043 AGCTAAAAAAGTTGATCTGGAGG - Intergenic
1192769660 X:74174658-74174680 AGCTAAAAAATGTGATCTCATGG - Intergenic
1195344319 X:103934191-103934213 AGCTAAAAAAGTTGATCTCAAGG - Intronic
1195362637 X:104099054-104099076 AGCTAAAAAAGTTGATCTCAAGG + Intergenic
1195794812 X:108633752-108633774 ACTTAACAAAGATGATATTGTGG + Intronic
1197329846 X:125140374-125140396 AGCTAAAAAAGTTGATCTCATGG + Intergenic
1198606728 X:138347636-138347658 ACCAAACAAAGATGATCTTGGGG + Intergenic
1198829800 X:140737672-140737694 AGCTAAAAAAGTTGATCTCATGG - Intergenic
1201786288 Y:17784974-17784996 AAATAACAAAGTTGATCTCATGG + Intergenic
1201815265 Y:18121014-18121036 AAATAACAAAGTTGATCTCATGG - Intergenic