ID: 1051472039

View in Genome Browser
Species Human (GRCh38)
Location 9:17454714-17454736
Sequence GGTGCTTGTCTACCTAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051472039_1051472040 -5 Left 1051472039 9:17454714-17454736 CCTTTGTTAGGTAGACAAGCACC 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1051472040 9:17454732-17454754 GCACCATCTCTTTTTAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051472039 Original CRISPR GGTGCTTGTCTACCTAACAA AGG (reversed) Intronic
903890369 1:26566069-26566091 GTTGATTGTATACCTAGCAATGG + Intronic
913031875 1:114915445-114915467 AGTTCATGTCTACCTAACAAAGG + Intronic
917778091 1:178360353-178360375 GTTGCTTCTCTAGCTAACATTGG + Intronic
920357068 1:205381681-205381703 GGTGTTTGTCTACCTGACTGTGG - Exonic
921394770 1:214656875-214656897 GATGCTTCTCTAGTTAACAATGG - Intronic
924237301 1:242009937-242009959 GGTGCCTGTCTTCCTCTCAAAGG - Intergenic
1068678181 10:59789805-59789827 AGTTCATGTCTACCTAACAAAGG + Exonic
1069211313 10:65763138-65763160 GCTGCTTGTATAACTAACTAAGG + Intergenic
1074545080 10:114395859-114395881 GTGGCTGGTCTACCTAAGAAGGG - Intronic
1080475826 11:32590065-32590087 GGTGCTTTTATACCTGACATAGG - Intronic
1099488840 12:83262122-83262144 GGTCCTTGTCTACCAAATGATGG - Intergenic
1101242896 12:102855859-102855881 AGTGCATGCCTACCAAACAAAGG - Intronic
1101493313 12:105230211-105230233 GGAGTTTGTCTTCCTAAAAACGG - Intronic
1112851110 13:103707614-103707636 AGTACTTGTCTACATAACAGAGG - Intergenic
1113180897 13:107624802-107624824 GTTGCTTATCTTCCTAATAAAGG + Intronic
1117305803 14:54471986-54472008 GGGGCATTTCCACCTAACAAAGG + Intergenic
1122034717 14:98938980-98939002 GGTGCTTTTCTAGCCCACAAGGG + Intergenic
1128659117 15:69484902-69484924 GGTGCTTGTCTCCCTGAGAAAGG - Intergenic
1131210094 15:90487607-90487629 AGAGCTTATCTACCAAACAAAGG - Intronic
1138786127 16:59848827-59848849 TGTGCTTGTCTACTTTAAAAAGG + Intergenic
1147966994 17:44199229-44199251 GGGGCCTGGCTCCCTAACAAAGG + Intronic
1152433745 17:80262997-80263019 GGCGCTTGGCCACCTAACAGTGG - Intronic
1159845705 18:73457287-73457309 GGTGGTGGTGTACATAACAAAGG + Intergenic
1161063431 19:2226521-2226543 GGTGCTTCTCTTCCCCACAAGGG + Exonic
1168267603 19:55231054-55231076 GGTGCTTGTCTTCCTGTCCAGGG - Intronic
929979377 2:46664435-46664457 GATGCTTGTCTACCTGTCACTGG + Intergenic
941944762 2:171083138-171083160 GGATCTTGTCATCCTAACAATGG - Intronic
944899699 2:204201669-204201691 GGTGCTGGGCAACATAACAAGGG + Intergenic
1184079859 22:42211785-42211807 AGTGATGGTCTGCCTAACAAGGG - Exonic
975166530 4:71184393-71184415 GGTGCTTGTCATCGAAACAAAGG + Intergenic
981636638 4:146888480-146888502 GCTGCTTGTAGACCTAACACTGG + Intronic
983449539 4:167893598-167893620 GGTGCTTCTCTACCTGTCAGCGG + Intergenic
983953054 4:173664624-173664646 AGGCCGTGTCTACCTAACAAAGG + Intergenic
984997218 4:185446439-185446461 GGTCCCTGGATACCTAACAATGG + Intronic
993036572 5:82764990-82765012 GATGCTTGTCAACTTAACAATGG + Intergenic
994789834 5:104209647-104209669 ATTGATTGTCTAGCTAACAATGG + Intergenic
994972060 5:106753204-106753226 GGTGTTTGTACACCTAAAAATGG + Intergenic
1002442407 5:179271247-179271269 GGTGCTTGTCTTCCTGAACATGG - Intronic
1011468241 6:87681002-87681024 GGTACATCTATACCTAACAAAGG + Intronic
1012553453 6:100485214-100485236 GGTGGTTGGCTGCCTAAGAAAGG - Intergenic
1012963102 6:105643758-105643780 GGTGCTGGTGTACCTAAGTAGGG + Intergenic
1014004487 6:116402289-116402311 GGTGCTTTTCTACCACACTAGGG - Intronic
1044904735 8:96989303-96989325 GGAGCTTGTCTTTCTATCAAAGG + Intronic
1051472039 9:17454714-17454736 GGTGCTTGTCTACCTAACAAAGG - Intronic
1055330537 9:75178522-75178544 CGTGCCTGTGTATCTAACAAAGG + Intergenic
1058574978 9:106391136-106391158 GGAGCTTGTTTAGCTAAAAATGG + Intergenic