ID: 1051472040

View in Genome Browser
Species Human (GRCh38)
Location 9:17454732-17454754
Sequence GCACCATCTCTTTTTAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051472039_1051472040 -5 Left 1051472039 9:17454714-17454736 CCTTTGTTAGGTAGACAAGCACC 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1051472040 9:17454732-17454754 GCACCATCTCTTTTTAAATGAGG No data
1051472038_1051472040 6 Left 1051472038 9:17454703-17454725 CCTCGAGATCACCTTTGTTAGGT 0: 1
1: 0
2: 0
3: 18
4: 185
Right 1051472040 9:17454732-17454754 GCACCATCTCTTTTTAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051472040 Original CRISPR GCACCATCTCTTTTTAAATG AGG Intronic
No off target data available for this crispr