ID: 1051472989

View in Genome Browser
Species Human (GRCh38)
Location 9:17470699-17470721
Sequence ACATTAACAAGCCTGTATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051472989_1051472992 21 Left 1051472989 9:17470699-17470721 CCCTGATACAGGCTTGTTAATGT 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1051472992 9:17470743-17470765 GCCAAGCTCCATCTTTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051472989 Original CRISPR ACATTAACAAGCCTGTATCA GGG (reversed) Intronic
902116303 1:14124456-14124478 ACTTTAACAAGCCTGGATTATGG - Intergenic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
905930836 1:41786226-41786248 TCGTCAACAAGCCTGTATTAGGG - Intronic
906537088 1:46556997-46557019 GCATTACTAAGCCTTTATCAAGG - Intergenic
909604392 1:77493965-77493987 AAATTAATAAGCCTTTATCAAGG + Intronic
1064461874 10:15542835-15542857 TCATATACAAGCATGTATCATGG + Intronic
1066422013 10:35272339-35272361 ACATAGATAAACCTGTATCATGG + Intronic
1067359481 10:45565099-45565121 GCAATAACAACACTGTATCATGG + Intronic
1071048798 10:81419851-81419873 ATATTAACAAGCCTTTAACAGGG - Intergenic
1073713692 10:106076374-106076396 ACATTGACAAGCATTTATGAAGG + Intergenic
1079631281 11:22679480-22679502 ACATTAACAGTCCTGGATTATGG + Intronic
1081100400 11:38994603-38994625 ACATTAATAAGCATTTACCATGG + Intergenic
1083609020 11:63996375-63996397 ACATTCAGCAGCCTGTTTCAGGG + Intronic
1085054144 11:73394355-73394377 ACATTAACCAGCCTGCCTCCTGG + Intronic
1088904887 11:114147557-114147579 ACATCATCAAGCATGCATCATGG + Intronic
1094221041 12:27993881-27993903 TCATGAATAAGCCTGTACCAAGG - Intergenic
1097237817 12:57551686-57551708 CCTTTAACAAGCCTGTGTCCAGG - Intronic
1098045002 12:66391448-66391470 ACATTAAAAAGCCTCACTCATGG - Intronic
1107258797 13:38465317-38465339 AAATTGACAAGCCTCTGTCAAGG - Intergenic
1107262307 13:38508338-38508360 AAATTAATAAGCCTCTATCCAGG - Intergenic
1109081236 13:57903987-57904009 ACAAACACAAGCCTGAATCAAGG + Intergenic
1109469853 13:62790744-62790766 AATTTAACAAGCCTGATTCAGGG - Intergenic
1110621522 13:77601009-77601031 TTATTAACAAGCCTGTGTGATGG - Intronic
1110677262 13:78263563-78263585 ACATCATCAAACCTGGATCAGGG - Intergenic
1121435977 14:93920061-93920083 AAATTAACAAGCTTCTAGCAAGG + Intronic
1121806274 14:96827055-96827077 ACATTAATAAGCCTTTGTCTGGG + Intronic
1123814336 15:23961519-23961541 AAATTAACCAGCCAATATCATGG + Intergenic
1125046448 15:35246589-35246611 TCATTTAAATGCCTGTATCATGG - Intronic
1134762051 16:16723130-16723152 GAATTATCCAGCCTGTATCAAGG - Intergenic
1134984007 16:18636040-18636062 GAATTATCCAGCCTGTATCAAGG + Intergenic
1140503634 16:75456033-75456055 AGATTAAGAAGCCTGTGTAAAGG - Intronic
1146489887 17:33273386-33273408 AGAGTAACAACCCTATATCAGGG - Intronic
1147055961 17:37835344-37835366 GCATTAAACAGCCTGTAACAAGG + Intergenic
1150141763 17:62736204-62736226 ACTTTAACAAGCCAGCCTCAGGG - Exonic
1150927420 17:69547654-69547676 ACATTAACAAGCAACTTTCATGG - Intergenic
1156483802 18:37452167-37452189 ACATTACCAAGCGTGGCTCAGGG - Intronic
1157642378 18:49230499-49230521 ATATTAACAAGTCTCTGTCATGG - Intronic
1161678347 19:5666048-5666070 ACAACAACCAGCCTGTGTCAAGG + Intronic
1163080322 19:14935272-14935294 ACATTAACAAGCATGGATGCTGG - Intergenic
925012082 2:493737-493759 ACATAAATAAACATGTATCATGG + Intergenic
925345947 2:3171889-3171911 ACATCAACAAACATGTATCTTGG - Intergenic
926120848 2:10240562-10240584 ACATTAACAACCCTACCTCAGGG + Intergenic
927227436 2:20782727-20782749 AAATTAATAAGCCTGTAGCCAGG - Intronic
928207138 2:29293602-29293624 ACTTTAACATGCCTTTAACATGG + Intronic
933449129 2:82423792-82423814 ACATTAAAAAGCCTGTATAAGGG + Intergenic
940672393 2:156686803-156686825 ACATTATGAAGCCTGACTCAAGG + Intergenic
943708731 2:191064907-191064929 TCATTAACAGGTCTGTCTCATGG + Exonic
943871051 2:192999626-192999648 ACGTGAAAAAGTCTGTATCAGGG - Intergenic
945558509 2:211308572-211308594 ACATGAATATGCCTGTATCTTGG - Intergenic
946114605 2:217450479-217450501 ACTTTAGCAACCCTGTCTCAAGG - Intronic
948730062 2:239957144-239957166 ACATGCACAACCCTGCATCAGGG + Intronic
1169799667 20:9502137-9502159 ACACTTACAAACCTGTAACATGG + Intergenic
1174348092 20:49946481-49946503 ACATACACACTCCTGTATCAGGG - Intronic
1179205152 21:39269857-39269879 AAATTATCAAGCATGTATCAAGG + Intronic
950645867 3:14376371-14376393 ATTTTAACAAACCTGTATCTTGG - Intergenic
955374904 3:58386732-58386754 AAATCAAGAGGCCTGTATCATGG + Intronic
958256152 3:91327319-91327341 ACATCAAGAAGGCTTTATCAAGG - Intergenic
959865132 3:111258615-111258637 AAATTAACAAGAATGAATCATGG - Intronic
964832600 3:160901686-160901708 ACATCAACAAGTATGTACCAAGG - Intronic
965818296 3:172659301-172659323 AGATTAACAAGCAAGTATAAAGG + Intronic
968867338 4:3221810-3221832 AGATTAAAAAGAGTGTATCAAGG - Intronic
969906171 4:10397830-10397852 ACATTAAAAAGCATTTAACAGGG - Intergenic
971964069 4:33528725-33528747 ACACTAACAAGTCAGTATAAGGG - Intergenic
974631902 4:64502437-64502459 ACATTAAGAAGTCTGAAGCAAGG + Intergenic
977284783 4:95089294-95089316 ACAACAAAAAGCCTGTATCTGGG - Intronic
981450391 4:144890413-144890435 ACATTAACAAACCTTGTTCAGGG - Intergenic
981833229 4:149025935-149025957 ACATGAACTAGCATATATCAAGG - Intergenic
984288260 4:177761389-177761411 CCATTACCAAGCCTGTAAGATGG + Intronic
985218971 4:187682389-187682411 ACAATCACAAACCTGTTTCAAGG - Intergenic
985365537 4:189227643-189227665 ACAGTAACAAGGCTCTATGAGGG + Intergenic
989067383 5:37477955-37477977 ACATTTAAATGCCTGAATCAAGG - Intronic
989754326 5:44934748-44934770 AAATTTTCAAGCCTGTATCCAGG - Intergenic
995042249 5:107602328-107602350 ACATTAACAGGCCTGTTTCGAGG - Intronic
996690523 5:126335271-126335293 ACATGAACAATCCTGTCCCAAGG + Intergenic
997372824 5:133372868-133372890 ACATGAAGAAGCCTGTTACAAGG - Intronic
998993566 5:147845960-147845982 TCATTTACAAGGCTGGATCAGGG + Intergenic
1000408118 5:160910145-160910167 CTCTTAAGAAGCCTGTATCAGGG + Intergenic
1000729284 5:164811582-164811604 GCATTAACAAGCAGTTATCAAGG + Intergenic
1004496351 6:16166803-16166825 TCATCAACAAGTCTGAATCATGG - Intergenic
1008999186 6:57693859-57693881 ACATCAAGAAGGCTTTATCAAGG + Intergenic
1015531930 6:134229286-134229308 ACAAGAATAAGCCTGTATCCTGG + Intronic
1016178665 6:141114811-141114833 ACTTTAAAAACACTGTATCATGG + Intergenic
1017931778 6:158961746-158961768 ACTTTAAGAAGCCTTTCTCAGGG - Intergenic
1018590853 6:165420186-165420208 ACATTAACAAGCAGGGAGCAGGG - Intronic
1019215609 6:170441054-170441076 ACATTAAAAGACCTGTTTCAAGG + Intergenic
1023478477 7:40606682-40606704 ACATGATCAAGTCTTTATCATGG + Intronic
1023660115 7:42462365-42462387 ACATTAATGAGCCCTTATCATGG + Intergenic
1024445093 7:49468297-49468319 ACAATAACAACCCTGTCTCTGGG - Intergenic
1025118230 7:56276750-56276772 ACTTTTACAAGTGTGTATCAAGG - Intergenic
1026258488 7:68733674-68733696 ACAATGACAAACATGTATCAAGG + Intergenic
1027351359 7:77315037-77315059 GCATTCTCAAGCCTGTCTCACGG + Intronic
1030980781 7:116182785-116182807 TCATTGCTAAGCCTGTATCATGG - Intergenic
1032259124 7:130320607-130320629 ATATTAACAAGCCTGTTACATGG - Intronic
1034064228 7:148120983-148121005 ACAGCAACAAGCCTCCATCATGG - Intronic
1034109730 7:148525147-148525169 ACATTGTCTAGTCTGTATCACGG + Intergenic
1034815973 7:154172284-154172306 ACATTAACAAGAAAATATCAAGG + Intronic
1035856050 8:2977558-2977580 ACATACACATGCATGTATCATGG + Intronic
1036393859 8:8349776-8349798 AAATTAACAGGCCTGCACCATGG - Intronic
1037065488 8:14571882-14571904 AAATAAACAAGCAAGTATCATGG - Intronic
1038302982 8:26372519-26372541 AAATTAAAATGCCTCTATCAAGG + Intronic
1042417136 8:68534227-68534249 ACATTAAGGAGATTGTATCATGG + Intronic
1044896272 8:96895416-96895438 ACATTAAAAATTCTGTTTCAAGG - Intronic
1048088766 8:131214895-131214917 AAATTATAAAGCCAGTATCAAGG - Intergenic
1051472989 9:17470699-17470721 ACATTAACAAGCCTGTATCAGGG - Intronic
1055378440 9:75677988-75678010 AAATTAATAAGCCTCTATCCAGG + Intergenic
1057326360 9:94068079-94068101 TAATTAACAAGACTGTTTCATGG + Intronic
1057695707 9:97321774-97321796 ACATTGACAAGGAAGTATCAAGG + Intronic
1057745463 9:97747532-97747554 ACACAAACAAGCCTGTGCCAGGG - Intergenic
1058020756 9:100085137-100085159 ACAATAACTAGTGTGTATCAAGG + Intronic
1196086931 X:111693544-111693566 ACATTAAGAAGCATGTATTCTGG - Intronic
1198066696 X:133105075-133105097 ATATGAACAAACCTATATCAAGG + Intergenic
1199431030 X:147760173-147760195 ACATTAACATTTCTGTATAAGGG + Intergenic
1202269995 Y:23062106-23062128 GCCTTAACCAGCCTGTATGATGG + Intergenic
1202296032 Y:23358576-23358598 GCCTTAACCAGCCTGTATGATGG - Intergenic
1202422989 Y:24695851-24695873 GCCTTAACCAGCCTGTATGATGG + Intergenic
1202447800 Y:24974235-24974257 GCCTTAACCAGCCTGTATGATGG - Intergenic