ID: 1051473927

View in Genome Browser
Species Human (GRCh38)
Location 9:17481535-17481557
Sequence AGATGTACGCTGCAGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051473927_1051473934 28 Left 1051473927 9:17481535-17481557 CCACCCAACTGCAGCGTACATCT 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1051473934 9:17481586-17481608 TGTGCAGCCCTGCCTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051473927 Original CRISPR AGATGTACGCTGCAGTTGGG TGG (reversed) Intronic
900788316 1:4663559-4663581 AAATGCAGGCTGCAGGTGGGAGG + Intronic
905043581 1:34979016-34979038 AGATTTAGGCTGTAGTTTGGGGG + Intergenic
905281141 1:36850194-36850216 AGATGGAGGCTGCAGGTAGGTGG - Intronic
905342547 1:37289273-37289295 AGATGTAGGCTGCGGTTGGCTGG - Intergenic
910684900 1:89906118-89906140 AGAAGTAAACAGCAGTTGGGGGG - Intronic
922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG + Intergenic
924048379 1:240055454-240055476 AGAGGTACCCTGCAGTTAGCTGG - Intronic
924710925 1:246529455-246529477 AGATGCTCACTGCAGTGGGGTGG - Intergenic
1073605752 10:104894211-104894233 AGAGAAACGCTGCAGTTGAGAGG - Intronic
1075418455 10:122282963-122282985 AGATGAAAGCAGCAGTTGGCAGG + Intronic
1075623043 10:123941683-123941705 AGCCGTCCGCTGCAGGTGGGAGG - Intergenic
1076346866 10:129785215-129785237 GGATGGGCGCTGCAGTGGGGCGG + Intergenic
1076438476 10:130462875-130462897 AGATGCACACTGCAGTGGTGGGG + Intergenic
1078507444 11:11962964-11962986 AGAGGTGTGCTTCAGTTGGGTGG + Intergenic
1084370818 11:68741543-68741565 AAATGTAAGCTGCAGGAGGGCGG + Intronic
1092730498 12:11528773-11528795 ATGTGTATGCTGCTGTTGGGTGG + Intergenic
1093765082 12:22953131-22953153 AGATGCTGGCTGCAGTGGGGAGG - Intergenic
1094036341 12:26075937-26075959 AGATGTAGGCTGGCGTTGGTGGG - Intronic
1097305778 12:58067526-58067548 AGTTGTACTCTGCTGTTGGCAGG - Intergenic
1100220544 12:92500403-92500425 AGATGTACCCTGGTGTTGAGTGG + Intergenic
1116288586 14:43004382-43004404 AGATGTTTTCTACAGTTGGGAGG + Intergenic
1116864642 14:50021855-50021877 AGATGAACACTTCAGTTGGAGGG - Intergenic
1118698631 14:68410763-68410785 AGATGTAAGATGCAATTTGGAGG + Intronic
1124190545 15:27572851-27572873 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124190552 15:27572897-27572919 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124190559 15:27572943-27572965 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1125964361 15:43861599-43861621 AGCTGTTCTCTGCAGGTGGGAGG + Intronic
1127383968 15:58452645-58452667 AGATGGAATCTGCAGTGGGGAGG + Intronic
1128180156 15:65595241-65595263 AGATATATGCTGCAGTAAGGAGG + Intronic
1128777473 15:70333363-70333385 ATATGTACTCTGCAGGTGTGGGG + Intergenic
1130997474 15:88912024-88912046 AGAGGGCCGGTGCAGTTGGGAGG - Intronic
1132579289 16:677754-677776 AGAGGGACGCGGCAGGTGGGAGG - Intronic
1136053914 16:27673697-27673719 GGATGTCCCCTGGAGTTGGGTGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141821186 16:86447159-86447181 AGATGTAGGCTGAGATTGGGGGG - Intergenic
1146700080 17:34949932-34949954 GAATGTATGCTGCAGTTGGTAGG - Intronic
1150518375 17:65838175-65838197 AAATGTCTGCAGCAGTTGGGTGG - Intronic
1150875067 17:68961776-68961798 AAATGTATGCTGCACCTGGGAGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1155332117 18:24729005-24729027 AGAGTGAGGCTGCAGTTGGGAGG - Intergenic
1158841033 18:61387705-61387727 TGATGTACAGTGCAGTTGGCTGG - Intronic
1159131161 18:64281592-64281614 AGAGGTTTGCTGCAGGTGGGAGG + Intergenic
926479843 2:13378073-13378095 AGATATGCTCTGCAGTGGGGAGG - Intergenic
926993695 2:18709803-18709825 ATGTGTACTCTGCTGTTGGGTGG + Intergenic
935377963 2:102419985-102420007 TGATGTACTCTGCATTTTGGTGG + Intronic
937348395 2:121142697-121142719 AGCTGTACCCTGCAGTTGGTGGG + Intergenic
937953116 2:127403533-127403555 ACCTGGAGGCTGCAGTTGGGAGG - Intergenic
939545437 2:143546570-143546592 AGATCTACACAGCAGTGGGGTGG - Intronic
940182608 2:150952687-150952709 AGATGTATCCTGCTGATGGGTGG - Intergenic
941151277 2:161918753-161918775 AGATGCCAGCTGCAGTAGGGAGG + Intronic
941621576 2:167785008-167785030 AGATGTACACGGCAGATGAGTGG - Intergenic
948260281 2:236599249-236599271 AGAAGCAGGCTGCAGTTGGCAGG - Intergenic
1170286513 20:14715596-14715618 AGAGGTTCTCTGCATTTGGGTGG - Intronic
1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG + Intronic
1180065673 21:45411052-45411074 AGGTGGACGCTGCAGCTGGGCGG + Intronic
1180150311 21:45943898-45943920 AGATGAACACTTCAGGTGGGGGG + Intergenic
1180150318 21:45943929-45943951 AGATGAACACTTCAGGTGGGGGG + Intergenic
951255780 3:20447775-20447797 AACTGCACCCTGCAGTTGGGTGG + Intergenic
951758486 3:26118320-26118342 AGCTGTGCTCTGCAATTGGGGGG - Intergenic
954809904 3:53241340-53241362 AAATGGATGCTGCAGTTGGCCGG - Intronic
956784557 3:72631634-72631656 AGATGGAGGCTGCATTTGGATGG - Intergenic
966234328 3:177683973-177683995 TGATGTACGGTGCAGCTGAGAGG - Intergenic
967234214 3:187368511-187368533 ACATGGACGCTGAAGTTGGATGG + Exonic
969334950 4:6502353-6502375 TGATGTACGGTGCAGCTGTGTGG + Intronic
986234808 5:5897397-5897419 ACATGTGCACTGCAGTTGGCAGG - Intergenic
988442050 5:31244487-31244509 ATGTGTTCCCTGCAGTTGGGAGG + Intronic
994279719 5:97886584-97886606 GGTTGTACCCTGCAGTTGGAGGG - Intergenic
995331933 5:110956351-110956373 AGATGCCAGCTGCAGTGGGGTGG + Intergenic
997801293 5:136865273-136865295 AGATGTAAGCTGCAGCAGGAGGG - Intergenic
998754977 5:145367841-145367863 AGATGTAGGTTGCAGGTGAGTGG - Intergenic
1022607348 7:31828573-31828595 ACATGAACTTTGCAGTTGGGTGG - Intronic
1024949083 7:54839694-54839716 AGATGCAGCCTGCAGATGGGAGG - Intergenic
1025139892 7:56454062-56454084 AGATGTACTCAGCAGTTGTCTGG - Intergenic
1025843539 7:65174599-65174621 ACATGGACACTGCAGGTGGGGGG - Intergenic
1025879505 7:65521367-65521389 ACATGGACACTGCAGGTGGGGGG + Intergenic
1025893933 7:65681221-65681243 ACATGGACACTGCAGGTGGGGGG - Intergenic
1029225457 7:99024181-99024203 ATGTGTACTCTGCTGTTGGGTGG - Intergenic
1030421313 7:109309964-109309986 AGAGGGAGGCTGCAGGTGGGTGG - Intergenic
1034324699 7:150220176-150220198 AGATGGAGGCTACAGTTGGCGGG - Intergenic
1034768492 7:153749055-153749077 AGATGGAGGCTACAGTTGGCCGG + Intergenic
1036461814 8:8960142-8960164 AGAAGTTCGCTGCAGGTGTGGGG - Intergenic
1040915284 8:52562608-52562630 AGATGTGAGCTGGAGGTGGGGGG - Intronic
1047058975 8:121200146-121200168 AGATGTCTGCTGCTGTTGGCAGG - Intergenic
1047361202 8:124171139-124171161 AGATTTTCGCTTCTGTTGGGGGG + Intergenic
1047477097 8:125243132-125243154 AAATGTATGATGCAGTTGAGGGG + Intronic
1050444697 9:5707341-5707363 ATATGTATTCTGCTGTTGGGTGG + Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1055730381 9:79274475-79274497 AGATGTAAGCTGTAGGTGGATGG + Intergenic
1055750783 9:79502529-79502551 AAATGTCCCCTGTAGTTGGGTGG - Intergenic
1057421870 9:94919362-94919384 AGATACACACTGCAGTCGGGTGG + Intronic
1061257148 9:129459752-129459774 TGGTGTACGCTGCAGTGGCGGGG - Intergenic
1061650459 9:132044160-132044182 AGAAGTACTCTGAAGTTTGGGGG + Intronic
1062313363 9:135952114-135952136 ATCTGTCCGCTGCAGATGGGTGG + Intronic
1187595632 X:20769509-20769531 ATATGTATTCTGCAGTTTGGGGG - Intergenic
1193415442 X:81216945-81216967 ATATGTACCCAGCAGTAGGGTGG + Intronic
1194608133 X:96006389-96006411 AGATTTAGACTCCAGTTGGGAGG - Intergenic
1197069147 X:122272579-122272601 AGAGGTATGCTGCAAGTGGGAGG - Intergenic
1198189353 X:134287510-134287532 AGATGCCAGCTGCAGTGGGGGGG + Intergenic
1199735760 X:150685423-150685445 AGATGTCAGCTGGAGTTAGGGGG - Intergenic
1200894840 Y:8364242-8364264 AGATGTAAACTGCAGTTGAATGG + Intergenic