ID: 1051473934

View in Genome Browser
Species Human (GRCh38)
Location 9:17481586-17481608
Sequence TGTGCAGCCCTGCCTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051473931_1051473934 -1 Left 1051473931 9:17481564-17481586 CCTGCTTCATCATGCAGCCCAAT 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1051473934 9:17481586-17481608 TGTGCAGCCCTGCCTGAGCAAGG No data
1051473928_1051473934 25 Left 1051473928 9:17481538-17481560 CCCAACTGCAGCGTACATCTTGC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1051473934 9:17481586-17481608 TGTGCAGCCCTGCCTGAGCAAGG No data
1051473930_1051473934 0 Left 1051473930 9:17481563-17481585 CCCTGCTTCATCATGCAGCCCAA 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1051473934 9:17481586-17481608 TGTGCAGCCCTGCCTGAGCAAGG No data
1051473926_1051473934 29 Left 1051473926 9:17481534-17481556 CCCACCCAACTGCAGCGTACATC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1051473934 9:17481586-17481608 TGTGCAGCCCTGCCTGAGCAAGG No data
1051473925_1051473934 30 Left 1051473925 9:17481533-17481555 CCCCACCCAACTGCAGCGTACAT 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1051473934 9:17481586-17481608 TGTGCAGCCCTGCCTGAGCAAGG No data
1051473927_1051473934 28 Left 1051473927 9:17481535-17481557 CCACCCAACTGCAGCGTACATCT 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1051473934 9:17481586-17481608 TGTGCAGCCCTGCCTGAGCAAGG No data
1051473929_1051473934 24 Left 1051473929 9:17481539-17481561 CCAACTGCAGCGTACATCTTGCA 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1051473934 9:17481586-17481608 TGTGCAGCCCTGCCTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051473934 Original CRISPR TGTGCAGCCCTGCCTGAGCA AGG Intronic
No off target data available for this crispr