ID: 1051478811

View in Genome Browser
Species Human (GRCh38)
Location 9:17537875-17537897
Sequence CCACTCTCAAGCCCTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051478811_1051478823 22 Left 1051478811 9:17537875-17537897 CCCTCACCAGGGCTTGAGAGTGG No data
Right 1051478823 9:17537920-17537942 CACTTGTACCTTTACCTGGGAGG No data
1051478811_1051478818 18 Left 1051478811 9:17537875-17537897 CCCTCACCAGGGCTTGAGAGTGG No data
Right 1051478818 9:17537916-17537938 GCCCCACTTGTACCTTTACCTGG No data
1051478811_1051478820 19 Left 1051478811 9:17537875-17537897 CCCTCACCAGGGCTTGAGAGTGG No data
Right 1051478820 9:17537917-17537939 CCCCACTTGTACCTTTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051478811 Original CRISPR CCACTCTCAAGCCCTGGTGA GGG (reversed) Intergenic