ID: 1051478814

View in Genome Browser
Species Human (GRCh38)
Location 9:17537881-17537903
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051478814_1051478818 12 Left 1051478814 9:17537881-17537903 CCAGGGCTTGAGAGTGGCCCATA No data
Right 1051478818 9:17537916-17537938 GCCCCACTTGTACCTTTACCTGG No data
1051478814_1051478823 16 Left 1051478814 9:17537881-17537903 CCAGGGCTTGAGAGTGGCCCATA No data
Right 1051478823 9:17537920-17537942 CACTTGTACCTTTACCTGGGAGG No data
1051478814_1051478826 28 Left 1051478814 9:17537881-17537903 CCAGGGCTTGAGAGTGGCCCATA No data
Right 1051478826 9:17537932-17537954 TACCTGGGAGGTCTCCTGCAGGG No data
1051478814_1051478825 27 Left 1051478814 9:17537881-17537903 CCAGGGCTTGAGAGTGGCCCATA No data
Right 1051478825 9:17537931-17537953 TTACCTGGGAGGTCTCCTGCAGG No data
1051478814_1051478820 13 Left 1051478814 9:17537881-17537903 CCAGGGCTTGAGAGTGGCCCATA No data
Right 1051478820 9:17537917-17537939 CCCCACTTGTACCTTTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051478814 Original CRISPR TATGGGCCACTCTCAAGCCC TGG (reversed) Intergenic