ID: 1051478816

View in Genome Browser
Species Human (GRCh38)
Location 9:17537898-17537920
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051478816_1051478826 11 Left 1051478816 9:17537898-17537920 CCCATAGGCACAAGCTCAGCCCC No data
Right 1051478826 9:17537932-17537954 TACCTGGGAGGTCTCCTGCAGGG No data
1051478816_1051478823 -1 Left 1051478816 9:17537898-17537920 CCCATAGGCACAAGCTCAGCCCC No data
Right 1051478823 9:17537920-17537942 CACTTGTACCTTTACCTGGGAGG No data
1051478816_1051478818 -5 Left 1051478816 9:17537898-17537920 CCCATAGGCACAAGCTCAGCCCC No data
Right 1051478818 9:17537916-17537938 GCCCCACTTGTACCTTTACCTGG No data
1051478816_1051478820 -4 Left 1051478816 9:17537898-17537920 CCCATAGGCACAAGCTCAGCCCC No data
Right 1051478820 9:17537917-17537939 CCCCACTTGTACCTTTACCTGGG No data
1051478816_1051478825 10 Left 1051478816 9:17537898-17537920 CCCATAGGCACAAGCTCAGCCCC No data
Right 1051478825 9:17537931-17537953 TTACCTGGGAGGTCTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051478816 Original CRISPR GGGGCTGAGCTTGTGCCTAT GGG (reversed) Intergenic