ID: 1051478818

View in Genome Browser
Species Human (GRCh38)
Location 9:17537916-17537938
Sequence GCCCCACTTGTACCTTTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051478814_1051478818 12 Left 1051478814 9:17537881-17537903 CCAGGGCTTGAGAGTGGCCCATA No data
Right 1051478818 9:17537916-17537938 GCCCCACTTGTACCTTTACCTGG No data
1051478810_1051478818 19 Left 1051478810 9:17537874-17537896 CCCCTCACCAGGGCTTGAGAGTG No data
Right 1051478818 9:17537916-17537938 GCCCCACTTGTACCTTTACCTGG No data
1051478813_1051478818 17 Left 1051478813 9:17537876-17537898 CCTCACCAGGGCTTGAGAGTGGC No data
Right 1051478818 9:17537916-17537938 GCCCCACTTGTACCTTTACCTGG No data
1051478811_1051478818 18 Left 1051478811 9:17537875-17537897 CCCTCACCAGGGCTTGAGAGTGG No data
Right 1051478818 9:17537916-17537938 GCCCCACTTGTACCTTTACCTGG No data
1051478816_1051478818 -5 Left 1051478816 9:17537898-17537920 CCCATAGGCACAAGCTCAGCCCC No data
Right 1051478818 9:17537916-17537938 GCCCCACTTGTACCTTTACCTGG No data
1051478817_1051478818 -6 Left 1051478817 9:17537899-17537921 CCATAGGCACAAGCTCAGCCCCA No data
Right 1051478818 9:17537916-17537938 GCCCCACTTGTACCTTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051478818 Original CRISPR GCCCCACTTGTACCTTTACC TGG Intergenic
No off target data available for this crispr