ID: 1051478821

View in Genome Browser
Species Human (GRCh38)
Location 9:17537918-17537940
Sequence TCCCAGGTAAAGGTACAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051478821_1051478830 14 Left 1051478821 9:17537918-17537940 CCCACTTGTACCTTTACCTGGGA No data
Right 1051478830 9:17537955-17537977 CCTAACCCACACAATCTTGTAGG No data
1051478821_1051478826 -9 Left 1051478821 9:17537918-17537940 CCCACTTGTACCTTTACCTGGGA No data
Right 1051478826 9:17537932-17537954 TACCTGGGAGGTCTCCTGCAGGG No data
1051478821_1051478825 -10 Left 1051478821 9:17537918-17537940 CCCACTTGTACCTTTACCTGGGA No data
Right 1051478825 9:17537931-17537953 TTACCTGGGAGGTCTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051478821 Original CRISPR TCCCAGGTAAAGGTACAAGT GGG (reversed) Intergenic
No off target data available for this crispr