ID: 1051478826

View in Genome Browser
Species Human (GRCh38)
Location 9:17537932-17537954
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051478817_1051478826 10 Left 1051478817 9:17537899-17537921 CCATAGGCACAAGCTCAGCCCCA No data
Right 1051478826 9:17537932-17537954 TACCTGGGAGGTCTCCTGCAGGG No data
1051478821_1051478826 -9 Left 1051478821 9:17537918-17537940 CCCACTTGTACCTTTACCTGGGA No data
Right 1051478826 9:17537932-17537954 TACCTGGGAGGTCTCCTGCAGGG No data
1051478822_1051478826 -10 Left 1051478822 9:17537919-17537941 CCACTTGTACCTTTACCTGGGAG No data
Right 1051478826 9:17537932-17537954 TACCTGGGAGGTCTCCTGCAGGG No data
1051478816_1051478826 11 Left 1051478816 9:17537898-17537920 CCCATAGGCACAAGCTCAGCCCC No data
Right 1051478826 9:17537932-17537954 TACCTGGGAGGTCTCCTGCAGGG No data
1051478814_1051478826 28 Left 1051478814 9:17537881-17537903 CCAGGGCTTGAGAGTGGCCCATA No data
Right 1051478826 9:17537932-17537954 TACCTGGGAGGTCTCCTGCAGGG No data
1051478819_1051478826 -8 Left 1051478819 9:17537917-17537939 CCCCACTTGTACCTTTACCTGGG No data
Right 1051478826 9:17537932-17537954 TACCTGGGAGGTCTCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051478826 Original CRISPR TACCTGGGAGGTCTCCTGCA GGG Intergenic
No off target data available for this crispr