ID: 1051484641

View in Genome Browser
Species Human (GRCh38)
Location 9:17594721-17594743
Sequence TCTCCTTGATGGTATCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051484636_1051484641 22 Left 1051484636 9:17594676-17594698 CCTCTGTGAAGTGTAGTGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1051484641 9:17594721-17594743 TCTCCTTGATGGTATCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051484641 Original CRISPR TCTCCTTGATGGTATCCTCT AGG Intronic
No off target data available for this crispr