ID: 1051484999

View in Genome Browser
Species Human (GRCh38)
Location 9:17598599-17598621
Sequence TCATCTGGATCAAGGCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051484999_1051485006 15 Left 1051484999 9:17598599-17598621 CCTTTAGGCCTTGATCCAGATGA No data
Right 1051485006 9:17598637-17598659 CTTTCTCTGACCTAGTAGGTTGG No data
1051484999_1051485007 21 Left 1051484999 9:17598599-17598621 CCTTTAGGCCTTGATCCAGATGA No data
Right 1051485007 9:17598643-17598665 CTGACCTAGTAGGTTGGATCAGG No data
1051484999_1051485003 11 Left 1051484999 9:17598599-17598621 CCTTTAGGCCTTGATCCAGATGA No data
Right 1051485003 9:17598633-17598655 ATCCCTTTCTCTGACCTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051484999 Original CRISPR TCATCTGGATCAAGGCCTAA AGG (reversed) Intronic