ID: 1051484999 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:17598599-17598621 |
| Sequence | TCATCTGGATCAAGGCCTAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051484999_1051485006 | 15 | Left | 1051484999 | 9:17598599-17598621 | CCTTTAGGCCTTGATCCAGATGA | No data | ||
| Right | 1051485006 | 9:17598637-17598659 | CTTTCTCTGACCTAGTAGGTTGG | No data | ||||
| 1051484999_1051485007 | 21 | Left | 1051484999 | 9:17598599-17598621 | CCTTTAGGCCTTGATCCAGATGA | No data | ||
| Right | 1051485007 | 9:17598643-17598665 | CTGACCTAGTAGGTTGGATCAGG | No data | ||||
| 1051484999_1051485003 | 11 | Left | 1051484999 | 9:17598599-17598621 | CCTTTAGGCCTTGATCCAGATGA | No data | ||
| Right | 1051485003 | 9:17598633-17598655 | ATCCCTTTCTCTGACCTAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051484999 | Original CRISPR | TCATCTGGATCAAGGCCTAA AGG (reversed) | Intronic | ||