ID: 1051485515

View in Genome Browser
Species Human (GRCh38)
Location 9:17604064-17604086
Sequence TACGCTTGTTACAAAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051485504_1051485515 30 Left 1051485504 9:17604011-17604033 CCGATATGTTGTTTTTAGTTTCT 0: 1
1: 0
2: 3
3: 97
4: 951
Right 1051485515 9:17604064-17604086 TACGCTTGTTACAAAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051485515 Original CRISPR TACGCTTGTTACAAAACTGC TGG Intronic
No off target data available for this crispr