ID: 1051487983

View in Genome Browser
Species Human (GRCh38)
Location 9:17629149-17629171
Sequence ACTTCATGGAAGGCAGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051487983_1051487989 10 Left 1051487983 9:17629149-17629171 CCCAGTTCTGCCTTCCATGAAGT 0: 1
1: 0
2: 2
3: 18
4: 258
Right 1051487989 9:17629182-17629204 GATTAGTCACAAGGCCTTTGTGG No data
1051487983_1051487988 1 Left 1051487983 9:17629149-17629171 CCCAGTTCTGCCTTCCATGAAGT 0: 1
1: 0
2: 2
3: 18
4: 258
Right 1051487988 9:17629173-17629195 TGTGATCTGGATTAGTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051487983 Original CRISPR ACTTCATGGAAGGCAGAACT GGG (reversed) Intronic
900960218 1:5914320-5914342 GCTACATGGGAGGCAGAAGTGGG + Intronic
901516588 1:9751361-9751383 ACTTCATGGAACTCACAAGTTGG - Intronic
904161495 1:28525324-28525346 ACTTCTTTGGAGGCAGAAATTGG + Intronic
904801351 1:33094929-33094951 AGTGCATGGCAGGCAGAACCAGG - Intronic
904895304 1:33812873-33812895 ACTTCAGGAAAGGCAGAAAAAGG - Intronic
906306323 1:44722226-44722248 GCTACATGGAAGACAGGACTTGG - Intronic
906852681 1:49268670-49268692 ACCTAATGGAAGCCAGAAGTGGG - Intronic
907614940 1:55913781-55913803 ACTGCATGGAAGGCTGTGCTCGG - Intergenic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
909003388 1:70245903-70245925 AGTTTATGGAAGGCATGACTGGG + Intronic
911092037 1:94025187-94025209 ACATCATTGAAGTGAGAACTAGG - Intronic
912261083 1:108112037-108112059 ACTTCAGGGGAGGCAGGTCTGGG - Intergenic
914803704 1:150977491-150977513 ACTGCAAGGCAGGCAGCACTTGG - Intergenic
915519502 1:156433308-156433330 ACTTCAAAGAAGGCAATACTGGG + Intergenic
915878620 1:159641995-159642017 TCTTCAGGGAAAGGAGAACTAGG - Intergenic
917333804 1:173908670-173908692 GCTTCTTGGGAGGCAGAGCTGGG - Intronic
917698587 1:177556016-177556038 ATTTTATGGAAGGCAGAACTAGG - Intergenic
917960111 1:180135694-180135716 ACATCATGGAATGCAGAGTTGGG - Intergenic
920201457 1:204262196-204262218 ACCCCTTGGTAGGCAGAACTGGG - Intronic
924078464 1:240366661-240366683 GCTACTTGGAAGGCTGAACTTGG - Intronic
924304445 1:242672765-242672787 TCTTCATGGAAGGGGGAAATAGG - Intergenic
1063486108 10:6422780-6422802 ACGACATGGAAGGCAGAAGCTGG + Intergenic
1064429977 10:15262470-15262492 ACATCCAGGAAGGCAGAACCGGG + Intronic
1066108813 10:32178609-32178631 GCTTCTTGGAAGGCAGAGGTTGG + Intergenic
1067432974 10:46256148-46256170 ACTTCCCAGAAGCCAGAACTAGG + Intergenic
1067534305 10:47097374-47097396 TCTTTTTGGTAGGCAGAACTTGG - Intergenic
1068182291 10:53536145-53536167 ACTGCTTGGAAGGCTGAAGTGGG - Intergenic
1068925202 10:62528392-62528414 GCTTAATGGCAGGAAGAACTTGG - Intronic
1068946504 10:62734812-62734834 ACTCCAAGGAAGGCAGTACTAGG + Intergenic
1069491660 10:68866541-68866563 GTTCCTTGGAAGGCAGAACTGGG - Intronic
1069566625 10:69467677-69467699 TCTTCTTGGAAAACAGAACTTGG + Intronic
1071085711 10:81866741-81866763 ACTTCCTGGAACACAGAAGTGGG - Intergenic
1071191058 10:83101558-83101580 ACTTAGTGGAAGGCACAATTTGG - Intergenic
1072093884 10:92157688-92157710 ACAACTTAGAAGGCAGAACTTGG - Intronic
1073831472 10:107388462-107388484 AGTTAATGAATGGCAGAACTAGG - Intergenic
1074413175 10:113245120-113245142 AATTCATGGAAGGCTCACCTGGG + Intergenic
1074543908 10:114387810-114387832 GCCTCATGGAAGGAAGCACTTGG + Intronic
1075405002 10:122188936-122188958 TGTTCATGGAAGGCAGTACCTGG + Intronic
1075533133 10:123247122-123247144 ACTACTTGGAAGGCTGAATTAGG - Intergenic
1075551874 10:123399034-123399056 AGCTCATGGAAGGCAGAGTTGGG - Intergenic
1079423500 11:20317452-20317474 ACTTCCTGAAAGCAAGAACTGGG + Intergenic
1079646554 11:22870239-22870261 ACTACTTGGGAGACAGAACTGGG + Intergenic
1080009643 11:27445030-27445052 ATTTCAAACAAGGCAGAACTCGG + Intronic
1080197903 11:29633065-29633087 CCTTCATGGGAGGCAGTGCTGGG - Intergenic
1080694122 11:34586042-34586064 ACATCATGGGAGGCAGAAGAGGG - Intergenic
1080961812 11:37169264-37169286 GTTTTATGGAAGGTAGAACTTGG - Intergenic
1081607321 11:44535532-44535554 ATTTCATGGAAGGCAACACAAGG - Intergenic
1082860047 11:57846963-57846985 ACTACTTGGAAGGCAGAAGCAGG - Intergenic
1083203478 11:61133605-61133627 CCTTGCTGGCAGGCAGAACTGGG - Intronic
1083851315 11:65369087-65369109 ACATAATGGAAGGCAAATCTTGG + Intergenic
1084940183 11:72608263-72608285 ACTTCCTGGAAGCCAGGTCTGGG - Intronic
1086841801 11:91694793-91694815 ACTACATGCAAGTCATAACTGGG + Intergenic
1087234916 11:95707221-95707243 ACATCACTGAATGCAGAACTGGG + Intergenic
1089749467 11:120640091-120640113 ACCTCATGCAAGAAAGAACTTGG + Intronic
1091252598 11:134156166-134156188 ACTTCTGGGAGGGCAGAGCTGGG - Intronic
1092122207 12:6052445-6052467 ACTTCATGGATGGGTAAACTGGG - Intronic
1095358543 12:41306766-41306788 GTTTTGTGGAAGGCAGAACTTGG - Intronic
1098632381 12:72740144-72740166 AGTTCAGGCAAGGCATAACTGGG + Intergenic
1101197623 12:102401435-102401457 TCCTCTTGGAAGGCATAACTGGG + Intronic
1101341947 12:103849874-103849896 ATGTCAAGGAAGGGAGAACTTGG - Intergenic
1101403004 12:104404522-104404544 GCATCTTGGAAGGCTGAACTGGG + Intergenic
1101529527 12:105561432-105561454 ACATCAAGTAAGGCTGAACTGGG + Intergenic
1101623542 12:106415878-106415900 ACTTTCTGGAAAGGAGAACTGGG - Intronic
1102301842 12:111777064-111777086 ACCTCCTTGAAGGCAGACCTGGG + Intronic
1103250462 12:119495575-119495597 ATTTCATGGAAGCAAAAACTTGG - Intronic
1103574717 12:121868998-121869020 ACTACTTGGAAGGCTGAGCTGGG - Intergenic
1103732709 12:123038551-123038573 GCTTCATGGAAGGCGGAGCCAGG + Intronic
1103733873 12:123046180-123046202 CCTTCAGGAAAGGCAGGACTGGG - Intronic
1109726375 13:66346649-66346671 ACTTCTGGAAATGCAGAACTGGG + Intronic
1111255098 13:85657285-85657307 ACTTTAAGGAAGGCAGTAATTGG + Intergenic
1111264013 13:85782981-85783003 ACCATATGAAAGGCAGAACTTGG - Intergenic
1112677746 13:101723061-101723083 ACTTCAGGGAAAACAGAAATGGG - Intronic
1114858444 14:26483840-26483862 ACTAAATGTAAGGCAGAATTTGG + Intronic
1115673803 14:35646629-35646651 ACTGCATGTAAGGCATAATTTGG + Intronic
1117311448 14:54527850-54527872 ACTTCTTGGAAGGCTGAGGTAGG - Intronic
1120234618 14:81876197-81876219 ACCACATGGAAGCCACAACTTGG - Intergenic
1120948838 14:90022480-90022502 GAGTCATGGAAGGCAGATCTAGG - Intronic
1122409770 14:101519882-101519904 AGGTCATGGAAGGCAGATGTGGG + Intergenic
1122813845 14:104302539-104302561 AGCTCATGGGAGGCAGAGCTGGG - Intergenic
1123687152 15:22806858-22806880 ACTTCCTGCAGGGCAGAACAGGG + Intronic
1124091029 15:26600701-26600723 AATTCCTGTAAGGCAGAGCTAGG - Intronic
1125496224 15:40196976-40196998 TTTTCATGGAAGGCAGCAATGGG - Intronic
1126001706 15:44216898-44216920 ACCCCATGGAAGGCAAAAATTGG - Intergenic
1126308887 15:47293177-47293199 GCTTCATGCAAGGAAGAACCAGG - Intronic
1126377484 15:48010784-48010806 ACTTCATGGGAATCAGAAGTGGG + Intergenic
1126422480 15:48489485-48489507 TCTACATGTAAGACAGAACTGGG + Intronic
1126898225 15:53283087-53283109 AGTTCACAGAAGGCAGAACTGGG + Intergenic
1128942451 15:71799870-71799892 GCTACATGGAAGGCTGAAGTGGG - Intronic
1130098785 15:80876209-80876231 ACTTGATGGAAGGCAGCCCAGGG + Intronic
1131960856 15:97788925-97788947 CTTTCCTGGATGGCAGAACTTGG - Intergenic
1132912477 16:2321743-2321765 TGTTCATGGAAGCCAGATCTTGG - Intronic
1134612407 16:15619712-15619734 ACTGCAGAGAAGGCAGAACTGGG - Intronic
1135121677 16:19771428-19771450 ACTTCGTGGTAGGCAGAATTTGG - Intronic
1135687028 16:24506119-24506141 ACTTCTTGGAAGGCTGAGGTGGG - Intergenic
1136096589 16:27961468-27961490 ACCTCATGAGAGGCAGAGCTGGG - Intronic
1137705621 16:50533848-50533870 TGTTCATGGAAGAAAGAACTGGG + Intergenic
1138023022 16:53502142-53502164 GCTTAATGACAGGCAGAACTGGG - Intronic
1138562326 16:57809043-57809065 GCTTCTTGGAAGGCAGAGGTGGG + Intronic
1141082115 16:81061703-81061725 CCTTCAGGGGAGGCAGAACTAGG + Exonic
1142020249 16:87777824-87777846 ACTTCCTGGAAGGCGGGAGTTGG - Intergenic
1143369973 17:6433477-6433499 ACTACTTGGAAGGCTGAAGTGGG + Intronic
1144152457 17:12463100-12463122 ACTTCAATGGAGGCACAACTTGG + Intergenic
1145802463 17:27697076-27697098 ATTCCTTGGAAGGCAGAACTGGG + Intergenic
1148250805 17:46078297-46078319 AATGCAGGGAAGGCAGAATTTGG - Intronic
1148367180 17:47064307-47064329 ACCACATGGAGGACAGAACTCGG + Intergenic
1148768567 17:50053851-50053873 ATTTTATGGGAGGCAGAGCTAGG - Intergenic
1148867424 17:50635696-50635718 AGTTCAATGAAGGCAGAGCTGGG + Intronic
1149019688 17:51948612-51948634 ACTTCAGGGACGGCAGAATAAGG - Intronic
1149195271 17:54111892-54111914 ACTTCAAAGGTGGCAGAACTTGG - Intergenic
1150032699 17:61755927-61755949 ACTTCATAAAAGGGAGAATTTGG + Intronic
1150609318 17:66721031-66721053 ATTTCATGGAAGAAAGAATTTGG + Intronic
1151085709 17:71378236-71378258 ACTGCATAGTAGTCAGAACTAGG + Intergenic
1155142116 18:23053235-23053257 CCTTCATGGAAGACAGACCTGGG - Intergenic
1155491256 18:26404137-26404159 GCTTCTTGGAAGGCTGAAGTTGG - Intergenic
1155589102 18:27404634-27404656 ACTTCTAGGAAGGAAAAACTGGG + Intergenic
1156898060 18:42269467-42269489 ACTTTAAGGAAAGCAGAATTTGG - Intergenic
1158267867 18:55679854-55679876 ACTACTTGGAAGGCTGAGCTGGG + Intergenic
1159080104 18:63726940-63726962 ACTAGGTGGAAGGCAGGACTTGG - Intergenic
1161163272 19:2772334-2772356 ACTTCTTGGAGAGCAGATCTGGG - Intronic
1163197409 19:15732782-15732804 ACTTCATTGAAGGCAGCCCCAGG + Intergenic
1163546632 19:17944613-17944635 AGTTCTAGGAAGCCAGAACTAGG - Intergenic
1164925803 19:32129108-32129130 TGTCCCTGGAAGGCAGAACTTGG - Intergenic
1165137608 19:33679803-33679825 CCTTCTTGGAAGGAAGATCTGGG - Intronic
1165708632 19:37994004-37994026 GCTTCTTGGAAGGCTGAAATAGG - Intronic
1165746904 19:38234908-38234930 CCTTCATGGCAGGGAGAAGTAGG + Intergenic
1166001816 19:39881954-39881976 GCCTCATGGAAGGGAGAAATTGG - Intronic
1166004597 19:39898205-39898227 GCCTCATGGAAGGGAGAAATTGG - Intronic
1166680467 19:44763132-44763154 ACTTCCTGGATGGCATCACTGGG + Intergenic
1166700054 19:44877270-44877292 CCTGCATGCAAGGCATAACTGGG - Intronic
1167407872 19:49325457-49325479 ACTTCATGTAAGGAAGAAGAGGG + Intergenic
925112741 2:1350253-1350275 TCTTCCTGGAAAGCGGAACTTGG + Intronic
925588233 2:5484628-5484650 ACTTCATGGATGGAAGAGATAGG + Intergenic
928074123 2:28247491-28247513 TCTTCATGGAAGGGAGAAAAAGG - Intronic
929719027 2:44347412-44347434 ACTTTATGAAAGGAAGAACCAGG + Intronic
929756680 2:44771746-44771768 ACTTGACAGAAGGCAGAGCTGGG - Intronic
930325131 2:49906707-49906729 ACTACTTGGAAGGCAGAAGTGGG + Intergenic
932797855 2:74712916-74712938 ACTCCTTGGAAGGCAGCACAGGG + Intergenic
933089546 2:78104002-78104024 ACTCCATGGAAAGCAGTGCTGGG + Intergenic
937791311 2:125965315-125965337 ACATCATGGCAGGCGGAAGTGGG - Intergenic
939472595 2:142643168-142643190 ACTTGTGGGAAGGAAGAACTAGG + Intergenic
939793651 2:146614172-146614194 ATTTCTTGTAAGGCAGGACTAGG + Intergenic
940859665 2:158758892-158758914 ACTACTTGGAAGGCTGAAGTGGG - Intergenic
941636986 2:167945536-167945558 ACTTCATGCAAGAAAGAATTTGG - Intergenic
942737590 2:179133291-179133313 ATATGATGGAAGGCATAACTTGG - Intronic
943328334 2:186528266-186528288 AATTCTTGGAAGGCTGAAGTGGG - Intergenic
943569314 2:189554515-189554537 ACTACATGGAAGGCTGAGGTGGG - Intergenic
945368347 2:208984621-208984643 GCTCCATGGAAGGCAGGACTAGG + Intergenic
946443471 2:219717079-219717101 ACTGCTTGGAAGGCTGAAGTGGG + Intergenic
1168751330 20:284001-284023 ACTACATAGAAGGCGGAAGTTGG - Exonic
1169655620 20:7919584-7919606 ACTTCATGGATGGCAAGACTGGG - Intronic
1170307296 20:14952542-14952564 TTTTGATGGAAGGCAGTACTGGG - Intronic
1171447904 20:25217659-25217681 AGGTCATGGATGGCAGATCTGGG + Intronic
1173170459 20:40719331-40719353 TCTTCAAGGAAGGCAAATCTGGG + Intergenic
1173337021 20:42120522-42120544 ACCTTATGGAAGGCTGACCTGGG + Intronic
1173586506 20:44186995-44187017 ACTTCTTGGAAGGCAGACTTGGG - Exonic
1174186812 20:48711942-48711964 ACCTCAGGGTTGGCAGAACTTGG + Intronic
1174945152 20:54976833-54976855 ACTTCATGCAAGCAGGAACTGGG + Intergenic
1175782849 20:61694595-61694617 ACTTGGAGGAAGGCTGAACTGGG + Intronic
1177459891 21:21396684-21396706 ACTCCATGCAAGGCTGAACCAGG + Intronic
1177504995 21:22008089-22008111 ACTTTGTGGAAGGCAGAATTTGG - Intergenic
1181409661 22:22710178-22710200 ACTTCAGGGAAAGCAGTGCTGGG + Intergenic
1181417116 22:22768359-22768381 ACTTCAGGGAAAGCAGTGCTGGG + Intronic
1181451849 22:23027937-23027959 ACCTCATGCAAGAAAGAACTTGG + Intergenic
1181896161 22:26109736-26109758 ACTTCCAGGATGGCACAACTGGG - Intergenic
1183336396 22:37249760-37249782 ACTACCTGGGAGGCAGAAGTGGG - Intergenic
1185307052 22:50125068-50125090 AATTCTGGGAAGGCAGAATTTGG - Intronic
949883402 3:8678161-8678183 ACTTCATGTATGGCAGAAAGTGG - Intronic
949884030 3:8680673-8680695 ACTTCATGTATGGCAGAAAGTGG - Intronic
949963611 3:9336081-9336103 AGTTCAAGGAAGGAAGACCTAGG - Intronic
951764874 3:26186525-26186547 ACATCATGGAAGCCAGAATGGGG + Intergenic
951866637 3:27316036-27316058 ACTCCATGGAGGGCATTACTGGG + Intronic
952488022 3:33835604-33835626 GCTTCTTGGAAGGCTGAAGTGGG + Intronic
952499284 3:33944907-33944929 ACTTCATTGGTGGCAGAACATGG - Intergenic
952672002 3:35980670-35980692 ACTTCGTGGAAGGCTGAGGTGGG - Intergenic
953779902 3:45859120-45859142 ACAACATGTAAGGCAGAAATGGG + Intronic
954191597 3:48966196-48966218 AGATCTTGGAAGGCAGAATTGGG + Intronic
954341903 3:49961021-49961043 GCTTCTTGGAAGGCTGAAGTGGG - Intronic
955114231 3:55981455-55981477 ACTTCCTGTAAGGAAGAATTTGG - Intronic
956034152 3:65072370-65072392 ACTCAATGAAATGCAGAACTTGG + Intergenic
956682946 3:71798381-71798403 ATTTCATGGATGACAGAAATTGG + Intergenic
960467127 3:118010205-118010227 AAATCATGGAAGGGAGACCTGGG + Intergenic
961114655 3:124318334-124318356 GGTTCATGGGAGGCAGAAGTTGG + Intronic
961297928 3:125902003-125902025 ACATCATGATTGGCAGAACTTGG - Intergenic
961494579 3:127282384-127282406 CCTGCATGGAAAGCAGAATTAGG - Intergenic
961535483 3:127568070-127568092 ACCTCATGGGACGCAGAGCTGGG - Intergenic
961722544 3:128906398-128906420 ACTTCATGGAGGGCAGCAGTCGG - Intronic
961733642 3:128986349-128986371 GCTTCTTGGAAGGCTGAAGTGGG - Intronic
962048581 3:131787785-131787807 AGTTCCTGGAAGGCAGAATCTGG + Intronic
962673690 3:137735928-137735950 ACTTCATGGCCAGCACAACTAGG - Intergenic
963271223 3:143287641-143287663 ACTTCATGAATAGCAGCACTGGG - Intronic
963997187 3:151723019-151723041 CCTTCATGGAAGCCAGGGCTGGG + Intergenic
964130362 3:153280172-153280194 ACTTCATGGAATTCAGAGATTGG + Intergenic
968938702 4:3626771-3626793 GCTACACGTAAGGCAGAACTGGG - Intergenic
969954272 4:10872243-10872265 ACTTTATGGATGACAAAACTTGG + Intergenic
973835077 4:54801309-54801331 ACTTCCTGGAAGGCAGAATGAGG - Intergenic
974509910 4:62825632-62825654 TCTTCATGGTAGGCAGAAAAGGG + Intergenic
975068152 4:70096151-70096173 ACTTCAAGACAGGCAAAACTTGG - Intergenic
977521184 4:98086322-98086344 ACTTTATGGAAGGCAGATTTTGG - Intronic
977904999 4:102467183-102467205 GCTTTGTGGAAGGTAGAACTTGG + Intergenic
978887221 4:113778708-113778730 ACTGCATGGCTAGCAGAACTAGG - Intergenic
979832897 4:125322370-125322392 ACTCCAGGGAAGGCTGAGCTTGG - Intronic
981285291 4:143010453-143010475 GATTCATGGATGGCAGAAGTTGG + Intergenic
982273861 4:153619802-153619824 ACTTCATGGAAAGCAAAGATTGG - Intronic
982292899 4:153796824-153796846 CCCTCATGGAAGGCAGAATTGGG - Intergenic
984656324 4:182322498-182322520 AGCTGATGGAAGGCAAAACTTGG + Intronic
988096641 5:26621255-26621277 GCTACTTGGAAGGCTGAACTGGG + Intergenic
988180809 5:27789205-27789227 ACTTAATAGAAGGCAGTGCTTGG - Intergenic
992366418 5:76095239-76095261 ACTACATGGATGCAAGAACTGGG - Intronic
992737815 5:79741285-79741307 AGGTCATGGAAGGCGAAACTGGG + Intronic
995356140 5:111239591-111239613 ACTTCATGAGTGGCCGAACTGGG - Intronic
997542655 5:134677045-134677067 ACTGCAAGGATGGCAGAACGGGG - Intronic
998677514 5:144426171-144426193 GCTTGATAGAATGCAGAACTTGG - Intronic
998748411 5:145289041-145289063 ACTTTATGGAAGGAAGTAATGGG - Intergenic
1000393572 5:160749755-160749777 ACTTCCTGGAAGAAAGAACAGGG + Intronic
1001691770 5:173638700-173638722 CCTTGCTGGAAGGCAGAAATAGG + Intergenic
1001725770 5:173898394-173898416 AGTTAATGGAAGTCAGATCTGGG + Intronic
1001946991 5:175787530-175787552 ACTACTTGGAAGGCTGAGCTTGG - Intergenic
1002159889 5:177308872-177308894 ACTTCAGGGCTGGCAGAGCTTGG - Intronic
1004981710 6:21031625-21031647 ACATCTTGGAAGGTAGAAGTCGG + Intronic
1005270257 6:24156163-24156185 ACTCCATGGAAGGAAGAAGCAGG - Intergenic
1007682344 6:43643223-43643245 ACTTCTTTGTAGGCAGAAATTGG + Intergenic
1009921662 6:70069330-70069352 ATTTTACAGAAGGCAGAACTGGG - Intronic
1011947219 6:92921248-92921270 ATTTCATGGAGGCCAGAACAAGG + Intergenic
1012593171 6:101007995-101008017 TCTTCATGGAACCCAGAACAGGG + Intergenic
1013499135 6:110730083-110730105 ACTCCAATGAAGGCAGAAATGGG - Intronic
1014588993 6:123238138-123238160 ATTTCATAGAAGGCACTACTAGG + Intronic
1014827157 6:126059473-126059495 AGTTCATGGAAGGCAGAGGCTGG + Intergenic
1018529447 6:164747397-164747419 ACTTCATGGAAGGGAGAATTTGG - Intergenic
1019019786 6:168908709-168908731 ACTTCATGGAATGCAGAGTTCGG - Intergenic
1019140198 6:169937975-169937997 ACCTCAAGGAAGGCAGAAAGTGG + Intergenic
1021968767 7:25948025-25948047 ACGTCAGGGAAGGAAGAACAAGG - Intergenic
1022548073 7:31207808-31207830 AGTTCATGATAGGCAGCACTTGG + Intergenic
1023921859 7:44636125-44636147 AGTTCATGGGAGGCAGACCTAGG + Intronic
1028607336 7:92669562-92669584 ACTTCATCGCAGGAATAACTCGG - Intronic
1029019985 7:97354756-97354778 ACTATAGGGAAGGCAGAAGTGGG + Intergenic
1029409652 7:100400713-100400735 ACTTCAAGAAGGGCAGATCTGGG - Intergenic
1029865066 7:103619212-103619234 ACTTCATGGGAGATAGAATTGGG + Intronic
1030496547 7:110307819-110307841 ATTTCAGGAAAGGCAGAATTAGG + Intergenic
1030625985 7:111846611-111846633 ACTTCATGATACTCAGAACTTGG - Intronic
1033354774 7:140590758-140590780 ACTACTTGGAAGGCTGAAGTGGG + Intronic
1033738916 7:144252968-144252990 ACCTCATTGAAGCAAGAACTGGG + Intergenic
1033744131 7:144297986-144298008 ACCTCATTGAAGCAAGAACTGGG - Intergenic
1035767841 8:2121359-2121381 AGCCCATGGAAAGCAGAACTCGG - Intronic
1037625468 8:20602571-20602593 AATTCATGGAAGGCAGGAAAAGG - Intergenic
1040510384 8:48088101-48088123 ACTTCCTGGAAGGTAGTGCTTGG + Intergenic
1041492795 8:58453256-58453278 ACTTCTTTGGAGGCAGAAATTGG - Intergenic
1042091222 8:65161769-65161791 ACTACAGGGAAGGAAGAAATTGG + Intergenic
1042998150 8:74723786-74723808 TCTTCATGTAAGTCAAAACTGGG + Intronic
1043361018 8:79472052-79472074 ACTTGATGGAAGCTAGAACCAGG + Intergenic
1044547073 8:93471929-93471951 ACTTGATGGTGGGCAGGACTGGG - Intergenic
1045282503 8:100761271-100761293 ACGTCATGGTAGTCAGAGCTTGG + Intergenic
1046677148 8:117122443-117122465 AGCTCATGAATGGCAGAACTGGG + Intronic
1049928274 9:430979-431001 ACTACATGGGAGGCTGAAGTAGG - Intronic
1050224565 9:3437547-3437569 ACTTCAAGCAAGGGGGAACTTGG + Intronic
1051487983 9:17629149-17629171 ACTTCATGGAAGGCAGAACTGGG - Intronic
1054452039 9:65408564-65408586 GCTACACGTAAGGCAGAACTGGG + Intergenic
1056112490 9:83409416-83409438 TTTTGATGGAAGGCAGAAGTTGG - Intronic
1056910667 9:90697329-90697351 ACTTTATGAAAGGCAAAATTGGG - Intergenic
1057857869 9:98615882-98615904 AGTTCATAGATGACAGAACTGGG - Intronic
1058809163 9:108622562-108622584 ACTTTAAAGAAAGCAGAACTTGG + Intergenic
1059490379 9:114661610-114661632 TGTTCATGGAAGGGAGAACAGGG - Intergenic
1059665548 9:116443221-116443243 AGTTTATGGAAGGAAGACCTGGG + Intronic
1060201317 9:121653080-121653102 ACTTCAGGAAAGGCAGGAGTGGG - Intronic
1060284080 9:122233422-122233444 ACTTCCTGGCACGCTGAACTTGG + Intergenic
1060776508 9:126378564-126378586 CCTCCAAGGAAGGCAGTACTGGG - Intronic
1060855249 9:126909846-126909868 ACTTCATGGAGAGCCAAACTTGG - Intergenic
1061133144 9:128719487-128719509 AGGTCACAGAAGGCAGAACTCGG - Intronic
1061664219 9:132150977-132150999 GCTACATGGAAGGCTGAAGTGGG + Intergenic
1186334974 X:8576695-8576717 ACATCATTGATGGCAGAACAAGG + Intronic
1186868440 X:13744985-13745007 AGATCATGGATGGGAGAACTTGG - Intronic
1188955065 X:36424380-36424402 ACCTCATGGAAGAAAGAATTTGG - Intergenic
1192505757 X:71681172-71681194 ACATCACAGAAGTCAGAACTTGG - Intergenic
1193273581 X:79557618-79557640 CCCTCATGGAAGTCACAACTTGG - Intergenic
1193285089 X:79703761-79703783 ACTTCACAGAAGGCAGAAAAAGG + Intergenic
1193661290 X:84261979-84262001 ACTTCATGTGAGGAAGAAGTTGG - Intergenic
1194803142 X:98295884-98295906 ACTTCGTGCAAGAAAGAACTTGG - Intergenic
1196459622 X:115916841-115916863 ACTTCTTTGGAGGCAGAAATTGG + Intergenic
1196553999 X:117065187-117065209 TCTTCATGGAAAGCTGAACCAGG - Intergenic
1201428527 Y:13881570-13881592 ACATCATTGATGGCAGAACAAGG - Intergenic