ID: 1051488303

View in Genome Browser
Species Human (GRCh38)
Location 9:17632800-17632822
Sequence CAGGGAAGCCCCAAATAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051488303_1051488308 20 Left 1051488303 9:17632800-17632822 CCCTGCTATTTGGGGCTTCCCTG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 1051488308 9:17632843-17632865 TTCTGCTAATTAAATTGAATTGG No data
1051488303_1051488305 -6 Left 1051488303 9:17632800-17632822 CCCTGCTATTTGGGGCTTCCCTG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 1051488305 9:17632817-17632839 TCCCTGAAAAAGATTCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051488303 Original CRISPR CAGGGAAGCCCCAAATAGCA GGG (reversed) Intronic
900374861 1:2349064-2349086 CAGGGAAGCCCCCAAGCACAGGG - Intronic
900785884 1:4650225-4650247 CAGGGAAGCCCCAAAGGGGAGGG - Intergenic
904246209 1:29189958-29189980 CAGTGAAACCCCAAATACTAGGG + Intergenic
905329364 1:37181573-37181595 CAGGGGAGCCCCAAAGAGGGAGG - Intergenic
905652950 1:39668670-39668692 CAGGGAAGGCGGAAGTAGCAAGG - Intronic
907290159 1:53408435-53408457 CTGGGAAGCCCCAAAAAGATTGG - Intergenic
910697250 1:90032345-90032367 CAGGGAAGTATGAAATAGCATGG + Intronic
912960795 1:114193928-114193950 CAGGGAAGTCCTTTATAGCAGGG - Intergenic
913205861 1:116538108-116538130 CTAGGAAGCCCCAAGTAGAAAGG - Intronic
914847837 1:151292638-151292660 CAGGGAAGCCCCAACAAGTCTGG + Exonic
915071894 1:153276580-153276602 CAGGGAAGCCCCTAAAAAGAAGG + Intergenic
919702837 1:200649089-200649111 CAGAGAAGTCGCAAATAGAAAGG - Exonic
921269797 1:213457314-213457336 CATGGAATCCCCAGAGAGCACGG - Intergenic
922158478 1:223059707-223059729 CAAGGAGGACTCAAATAGCAGGG - Intergenic
923564315 1:235065266-235065288 CAGGCCAGCCTCAAATAGGAAGG + Intergenic
1070320858 10:75353567-75353589 CAGGGACTCCCCAAAAAGCCAGG + Intergenic
1070890999 10:79942191-79942213 CAGAGGAGCCCCAGAAAGCAAGG - Intronic
1071140098 10:82499465-82499487 ATGGTAAGCCCTAAATAGCAAGG - Intronic
1075630616 10:123998686-123998708 CAGGGAAGGCCAAAAGAGCAGGG - Intergenic
1075705322 10:124497153-124497175 CAGGGGAGCCCAGAATAGGAAGG - Intronic
1075881609 10:125857071-125857093 CAAGAAAGCATCAAATAGCATGG + Intronic
1076853970 10:133106243-133106265 CAGGGAAGCTCCAGCCAGCAGGG - Intronic
1077446015 11:2591265-2591287 CAGGAAAGCCCCAAGGGGCAGGG - Intronic
1077752189 11:4984833-4984855 CAGAGAACCCCCATAGAGCATGG - Intronic
1078448975 11:11426268-11426290 CAGGGAAGCCCCAAGGACCCCGG + Intronic
1079427407 11:20356763-20356785 CAGGGAAGCCACAGATGTCATGG - Intergenic
1083997421 11:66279122-66279144 CTGGGAAGCCCCCAACAGGAGGG - Intronic
1084076647 11:66783549-66783571 CAGTGAAACCCAAAATAACAAGG - Intronic
1084483499 11:69435136-69435158 CAAGGAACCCCCAAATCCCAAGG + Intergenic
1088551675 11:111019664-111019686 CAGGGAAGCCACAGAGCGCATGG - Intergenic
1089260370 11:117220073-117220095 CAGAGAAGGACCCAATAGCAGGG + Intronic
1089436342 11:118472019-118472041 CAGGGAAGCTTCAAATAGGAAGG + Exonic
1090613908 11:128497362-128497384 CAAGGCAGCTCCAAATTGCATGG + Intronic
1091797159 12:3304031-3304053 CAGGGAAGGCAGAAATCGCAGGG - Intergenic
1096624402 12:52885052-52885074 CAAGGCAGGCCCAACTAGCATGG + Intergenic
1101963709 12:109267903-109267925 CAGGGAAGCCTCCAAAAGCTGGG + Exonic
1103181676 12:118917728-118917750 CAGGGAAGCCCCCGAGAGCAAGG + Intergenic
1103228857 12:119311054-119311076 CTGGGAAGCCTCAAATGGCTGGG + Intergenic
1103422398 12:120797958-120797980 CAAGGAAGCCTCAATTAGAATGG + Intronic
1103519088 12:121525798-121525820 CACTGAAGACCCAAATATCATGG - Intronic
1104979551 12:132567677-132567699 CTGGGAAGCCCCCAGGAGCAGGG + Intronic
1106962668 13:35018136-35018158 CAAGGAAGCCACAAAAATCAAGG - Intronic
1107395445 13:40011867-40011889 CAGGCATGCCCCACACAGCAGGG + Intergenic
1111496142 13:89053416-89053438 AAGGGTAGCCACAAATAGCTTGG - Intergenic
1112183823 13:97109829-97109851 CAGAGGAGCCCTAAAAAGCAAGG - Intergenic
1112211210 13:97379653-97379675 CTGCGAAGCCCCAAATGGGAAGG + Intronic
1115530699 14:34324259-34324281 CAGGGAAGCCACAAATTTAATGG - Intronic
1117176001 14:53147521-53147543 AAGAGAAGCCCCAAATGCCATGG + Intronic
1117359596 14:54959918-54959940 CAGGGAGGCACCAAACCGCAAGG - Intronic
1118748460 14:68790399-68790421 GAGGGAAGCCCCCACCAGCAGGG + Exonic
1119044819 14:71309216-71309238 CAGGGAAGACTCAAAGGGCAAGG + Intergenic
1122347557 14:101069989-101070011 CAGAGAACCCCCAAATGTCAGGG + Intergenic
1124086348 15:26553948-26553970 CACAGCAGCCCCAAATACCAGGG + Intronic
1124421746 15:29529077-29529099 CAGGGAAGACTCAAATAGGCTGG - Intronic
1129606331 15:77026845-77026867 CAGGAGGGCCCAAAATAGCAGGG - Intronic
1129905908 15:79186896-79186918 CAGGGAAGCCCCAAGTGCGAAGG - Intergenic
1130751188 15:86714848-86714870 CAAGGAAGCTCCAAATAGGAGGG - Intronic
1131065109 15:89429676-89429698 GAGGGCAGCCCCCAACAGCAGGG - Intergenic
1131872741 15:96778384-96778406 CAGGGAAGCCCCCAAGATCCAGG - Intergenic
1133998609 16:10765890-10765912 AGGGGAAGCCACAGATAGCAAGG + Intronic
1137721377 16:50629584-50629606 CAGGGAAGCCCAAAAGCACAAGG + Intronic
1140194871 16:72847695-72847717 CAGGGACACCCCAAAAGGCAAGG + Intronic
1140486222 16:75295792-75295814 CAGGGAAGCTGCAGACAGCATGG + Intronic
1142054025 16:87980747-87980769 CAGGGCAGCCCCGCAGAGCATGG + Intronic
1142239668 16:88939535-88939557 CAGGACGGTCCCAAATAGCATGG + Intronic
1142687974 17:1588747-1588769 CAGGGAAACCCTAACTAGCCAGG - Intronic
1143662334 17:8333513-8333535 CAGGGAAGCCGCCAACACCAGGG - Intergenic
1144723609 17:17489297-17489319 CTGAAAACCCCCAAATAGCAAGG - Intronic
1145966762 17:28924503-28924525 CAGAGAATCACCAAAAAGCATGG + Intronic
1146649666 17:34598823-34598845 CAGGGAAACCCAAAATTGCTAGG - Intronic
1147587074 17:41658887-41658909 CAGGGAGGCCCCAACTTGCAGGG + Intergenic
1148019660 17:44545161-44545183 CAGGGAAGCACCACAGAGAAGGG + Intergenic
1149585363 17:57782759-57782781 CAGGGAGGCCCCAAATCAAAAGG - Intergenic
1152200721 17:78944406-78944428 CAGGGCCGCCCCACACAGCAAGG + Intergenic
1152204190 17:78965498-78965520 CATGAAAGCCCAACATAGCAGGG - Intergenic
1155872421 18:31044012-31044034 CAGGGAAGCCCCAGACTTCAGGG - Intergenic
1157417154 18:47513308-47513330 CTTGGAAGCCCCAGAGAGCATGG - Intergenic
1157561267 18:48648098-48648120 CAGGACAGGCTCAAATAGCATGG + Intronic
1157573622 18:48729942-48729964 CAGGGATGCCTCAAAATGCAGGG - Intronic
1157963827 18:52185722-52185744 CAGATATGCCCCAAATAGAATGG - Intergenic
1160199521 18:76784576-76784598 AAGGTAAGCCTCAAATATCATGG + Intergenic
1160658552 19:287632-287654 CACGGCAGCCCCAAACAGGAAGG + Exonic
1161389909 19:4015532-4015554 CAGGGAGTCCCCCAAGAGCACGG - Intronic
1163608696 19:18290235-18290257 CAGGGAAGCCCCAAGCAGAAGGG + Intergenic
1166731211 19:45060038-45060060 CAGGGAAGCCACACAAAACAGGG - Intronic
927985364 2:27406668-27406690 CAGAGAAGCAGCAAATAGTATGG + Intronic
928843734 2:35643530-35643552 CAGGGAAGGCCAAAATAGCTGGG + Intergenic
932065293 2:68551338-68551360 CAGTGAACCCCCAAATAGGATGG - Intronic
932735114 2:74248972-74248994 CAGGCAATTCCCATATAGCAGGG + Intronic
933632862 2:84676064-84676086 CATGGAATCCACAAATAGCCTGG - Intronic
937858733 2:126691638-126691660 CAGGGAAGTCCCAGAAAACAGGG - Intronic
942191188 2:173472127-173472149 CATGGAGGCCCCAGATATCATGG - Intergenic
946923939 2:224607416-224607438 CAGAGGAACCCCAAATAGCTCGG - Intergenic
947108935 2:226697834-226697856 CAGGGAAGGCCTCAATAGGAGGG + Intergenic
947715750 2:232338135-232338157 CAGGAGAGCCCCAAACAGGAAGG + Intronic
948286040 2:236786142-236786164 CAGTCAAGCCCAAAATATCAAGG + Intergenic
948672196 2:239575688-239575710 CAGGGCAGCCCCACACTGCAAGG + Intergenic
1169467703 20:5856116-5856138 CAAGCAAGCCCCAAATATCCAGG - Intronic
1169886375 20:10403144-10403166 CTGGGGAGGCCCACATAGCAAGG - Exonic
1174673641 20:52332227-52332249 CAAACAAGCCCCAAATAGCAGGG + Intergenic
1177797799 21:25797499-25797521 CAGGAACACCCCAAATAACAAGG + Intergenic
1179508636 21:41858121-41858143 CATGGAAGTCCCAAACAGAAAGG + Intronic
1184732665 22:46379270-46379292 ATGGGAAGCCCCAAATAACAAGG + Intronic
953719685 3:45344524-45344546 CTGGGAAGCCTCAAATGGCTGGG - Intergenic
956529085 3:70197537-70197559 CAGGGACTCCCCAAATACAAGGG + Intergenic
956607115 3:71083972-71083994 GAGGGAAACCCCAAATTACAAGG + Intronic
958975495 3:100663075-100663097 CAGGCAAGCTCAAAAAAGCATGG + Intronic
959653929 3:108779681-108779703 CAGAGAGGTGCCAAATAGCAAGG - Intergenic
964097302 3:152947078-152947100 GAGGGAAGCCTCACATGGCAGGG - Intergenic
964414609 3:156434053-156434075 CTTGGAAGCCTCAATTAGCATGG + Intronic
976886505 4:89991268-89991290 GAGAAAAGCCCCAAATAGCATGG - Intergenic
977290483 4:95160098-95160120 CAGGGAAGCCCAAAATTGTCTGG + Intergenic
981683223 4:147424066-147424088 AAGGGAGGCCCCAAATACTAGGG - Intergenic
983403759 4:167299094-167299116 CAGGGAAACACCACATAGCTAGG + Intergenic
986314504 5:6577544-6577566 CTGGGCAGCCCAAAATGGCAGGG - Intergenic
987299316 5:16582920-16582942 CAAGGAAGGGCCAAATGGCAGGG - Intronic
987927833 5:24364890-24364912 CAGGCAAGCCCCACTTGGCAAGG - Intergenic
988930172 5:36029476-36029498 CAGGGAAGTCTCACACAGCATGG + Intergenic
996054614 5:118969091-118969113 CAGGGAAGCCCCACCTAGTGAGG - Intronic
998770627 5:145540628-145540650 CAGCCAAGCCCCAAATATGAGGG + Intronic
1004299314 6:14442883-14442905 CAGGAAAGCCCCTCAGAGCAGGG - Intergenic
1004721530 6:18271934-18271956 TAAGGAAGCACAAAATAGCAGGG - Intergenic
1009189166 6:60608956-60608978 CTGGGAAGCCCAAAATTGAAGGG + Intergenic
1014461641 6:121703403-121703425 CAGGGAAGCTCAAACTGGCAGGG + Intergenic
1017822833 6:158061349-158061371 CAGGGAAGCCTCATATGGAAGGG + Intronic
1018427412 6:163695845-163695867 CAGGGAAGCCCCAAAGGGATAGG - Intergenic
1021076463 7:16310307-16310329 CAGAGATCCCCCAAAAAGCAAGG + Intronic
1021611079 7:22458669-22458691 CATGGAAGCCCCAAGAAGCTTGG + Intronic
1028215564 7:88128025-88128047 CAGGGGATCCCCAAATGACATGG - Intronic
1028540707 7:91940219-91940241 AAGGGAAGCCCCAAAGAGTCGGG + Intergenic
1029225943 7:99028527-99028549 CAGGGCAGCACCAACCAGCATGG + Exonic
1030186178 7:106764294-106764316 CATGACATCCCCAAATAGCAGGG + Intergenic
1031166135 7:118229242-118229264 CAGGGAAGCCCTCACTAGTAAGG - Intronic
1034954644 7:155326992-155327014 CAGGGAACCCCCAGACAGCAGGG + Intergenic
1035397368 7:158543988-158544010 CAGGGCAGCCCCAACTGGCCGGG + Intronic
1035855207 8:2967060-2967082 CATTCAATCCCCAAATAGCAAGG - Intronic
1036942386 8:13064107-13064129 CAGGGAAGCTCCAAAAAACAGGG - Intergenic
1037082223 8:14801600-14801622 CAGGGAAACACCATATAGAATGG + Intronic
1037480099 8:19296927-19296949 CAGAGAAGCCAAAAAGAGCATGG + Intergenic
1037599066 8:20378531-20378553 CAGGGAAGATCCTTATAGCAGGG + Intergenic
1037910690 8:22741992-22742014 CAGGGGAGCCCCAGATAGGGAGG - Intronic
1038307021 8:26414089-26414111 CAGGGAAGCCCAAAATTTGAAGG + Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042629793 8:70804251-70804273 CAGGAAATACCCAAACAGCAGGG - Intergenic
1042742312 8:72063603-72063625 CAGTTAAACCCCAAATCGCAAGG + Intronic
1043081805 8:75775423-75775445 CTGGGAAGACACAAATAGCTAGG - Intergenic
1046813288 8:118555946-118555968 CTGGAAAGCACCAAATACCAAGG - Intronic
1051130420 9:13853979-13854001 CAGGGAAGCCCCAAGCATCTGGG - Intergenic
1051488303 9:17632800-17632822 CAGGGAAGCCCCAAATAGCAGGG - Intronic
1053873015 9:42513580-42513602 CAGGGAGCCCCCAGAAAGCAGGG - Intergenic
1053899737 9:42782340-42782362 CAGGGAGCCCCCAGAAAGCAGGG + Intergenic
1054261909 9:62875253-62875275 CAGGGAGCCCCCAGAAAGCAGGG - Intergenic
1054269315 9:62953172-62953194 CAGGGAGCCCCCAGAAAGCAGGG + Intergenic
1054916148 9:70496976-70496998 CAGGGATGGCCCAAAGTGCAGGG + Intergenic
1057227901 9:93302130-93302152 CAGGGCAGCCCAAAAGAGAAGGG + Intronic
1057868301 9:98698963-98698985 CCTGGAATCCCCTAATAGCAAGG - Intronic
1057947762 9:99344597-99344619 CAGGGAAGCCCCCAGGGGCATGG + Intergenic
1058458533 9:105160916-105160938 CAGGGAGGCCACAACTAGTAAGG - Intergenic
1061090083 9:128421320-128421342 CAGGGAAGGCCCCAAGAGGAAGG - Intronic
1192944377 X:75949701-75949723 CAGGGAAGCCCCATCTGGTAAGG + Intergenic
1195155143 X:102115609-102115631 CAGGAAAGCCCCAAATGGCAGGG + Intergenic