ID: 1051489706

View in Genome Browser
Species Human (GRCh38)
Location 9:17647912-17647934
Sequence AGGTGGAAGAGGAAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1849
Summary {0: 1, 1: 2, 2: 15, 3: 181, 4: 1650}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051489706 Original CRISPR AGGTGGAAGAGGAAGGTGGG GGG (reversed) Intronic
900172302 1:1274913-1274935 AGGAGGCAGAGGAAGGAGGCTGG - Intergenic
900300353 1:1973868-1973890 CGGTGGAGGAGCAAGCTGGGAGG + Intronic
900315103 1:2052418-2052440 GGGAGGAAGAGGAAGGGGTGGGG - Intronic
900429238 1:2594143-2594165 AGGCAGAACAGGATGGTGGGAGG - Intronic
900471963 1:2859488-2859510 GGGAGGAAGAGGAAGGAAGGAGG + Intergenic
900471973 1:2859520-2859542 GGGAGGAAGAGGAAGGAAGGAGG + Intergenic
900471983 1:2859552-2859574 GGGAGGAAGAGGAAGGAAGGAGG + Intergenic
900479218 1:2890028-2890050 AGGTGGTAGAGGAAGGTGAAGGG + Intergenic
900610483 1:3542525-3542547 AGGAGGCAGAGGAAGGCAGGTGG + Intronic
900723250 1:4194377-4194399 AGGTGGAAGAGGATGGGGGGTGG + Intergenic
900748039 1:4374530-4374552 AGCTGGAAGTGAGAGGTGGGGGG + Intergenic
900798061 1:4721295-4721317 AGGCGGAAGAGGTATGTGGTGGG - Intronic
900916560 1:5643743-5643765 AGCTGGAAGAGGAAGGGCGGAGG + Intergenic
900925622 1:5704376-5704398 AGGCTGCAGAGGGAGGTGGGTGG + Intergenic
901018561 1:6244962-6244984 AGGTGGAGGGGAAAGGAGGGAGG - Intronic
901420320 1:9146331-9146353 AGGAGGAGGAGGAAGGGGGCGGG - Intergenic
901430724 1:9212856-9212878 TGGTAGAAGAGAAAGGTAGGAGG - Intergenic
901447911 1:9319411-9319433 AGGAGGAAGAGGAGGGAGGAAGG - Intronic
901502021 1:9658275-9658297 ATGTGGAAGACTGAGGTGGGAGG + Intronic
901646945 1:10721905-10721927 AGGTGGGAGTGGCAGCTGGGCGG - Intronic
901647560 1:10724775-10724797 AGGAGGCAGAGGAAGGCAGGTGG + Intronic
901689283 1:10962053-10962075 AGGAGGAGGAGGAAGGAAGGAGG - Intronic
901805607 1:11736557-11736579 TGGAGGAGGAGGAAGGTGCGCGG + Intronic
901905997 1:12411534-12411556 AGAGGGAAGAGGAGGGAGGGAGG + Intronic
901947500 1:12715523-12715545 TGGGGGATGTGGAAGGTGGGGGG + Intergenic
902079166 1:13809364-13809386 TGGTAGAAGAGGAAGGAAGGCGG + Intronic
902224042 1:14985258-14985280 AGGTGGGAGGCCAAGGTGGGAGG + Intronic
902224047 1:14985271-14985293 AGGTGGGAGGCCAAGGTGGGAGG + Intronic
902266161 1:15266751-15266773 AGGGGTCAGGGGAAGGTGGGGGG - Intronic
902270293 1:15299541-15299563 AGGTGGGACAGGAAGGCAGGTGG + Intronic
902343189 1:15797958-15797980 AGTAGGAAGAGGATGGTGAGGGG + Intergenic
902407312 1:16191825-16191847 AGAAGGAGGAGGAAGCTGGGGGG - Intergenic
902607093 1:17574832-17574854 AGCTGGAACAGGAAGTGGGGCGG - Intronic
902614877 1:17618372-17618394 TGGGGGAAGAGGAAGCTGCGAGG + Intronic
902785437 1:18730068-18730090 AGGTGAAAAAGGAAGGGGAGGGG + Intronic
902917510 1:19647559-19647581 AGGTGGGAGAGGCAGGGGAGGGG + Intronic
902922828 1:19677427-19677449 AGGAGGAAGGGGTAGGAGGGAGG - Intronic
903441065 1:23388145-23388167 TGGTGGAAGGGGAAGGAGGGTGG + Intronic
903549922 1:24150695-24150717 AGGAGGAGGAGGAGGGCGGGCGG + Intergenic
903582406 1:24381526-24381548 AAGTGTATGAGGCAGGTGGGTGG - Intronic
903809724 1:26028608-26028630 TGGTGGAGGGGGTAGGTGGGAGG + Intronic
903814965 1:26058211-26058233 ATCAGTAAGAGGAAGGTGGGGGG + Intronic
903950096 1:26991627-26991649 GGCTGGGAGAGGAAGGCGGGTGG - Intergenic
903989192 1:27253418-27253440 AGGAGGAGGAGGGAGGAGGGAGG - Intronic
904044872 1:27603154-27603176 AGGTGGACGGGGAGGGGGGGCGG - Intronic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904127019 1:28248117-28248139 AGGTAGGACAGGATGGTGGGAGG + Intergenic
904284183 1:29443498-29443520 TAGTGGAAGAAGGAGGTGGGAGG + Intergenic
904293060 1:29500014-29500036 AGGAGGAAGAGGCAGAGGGGAGG + Intergenic
904358028 1:29954101-29954123 AAGCAGAGGAGGAAGGTGGGAGG + Intergenic
904387187 1:30151101-30151123 AGGAGGAAGAAAAAGATGGGTGG - Intergenic
904462336 1:30687525-30687547 AGGTGAGAGAGGCAGGTGGCTGG - Intergenic
904463232 1:30692754-30692776 AGGAGGAAGAGGAAGCAAGGAGG + Intergenic
904480720 1:30791674-30791696 AGGAGGAAGAGAAAGAGGGGAGG + Intergenic
904622627 1:31784459-31784481 AGGAGGAAGAGGAAGTGGAGGGG - Intergenic
905006001 1:34711011-34711033 AGGTGGAGGAGGAAGAGGGCTGG - Intergenic
905303176 1:36999279-36999301 AGGTGGGAGAGGAAGCTGCAGGG + Intronic
905352121 1:37355096-37355118 AGGGAAAAGAGGAAGGAGGGAGG + Intergenic
905471122 1:38192728-38192750 AGGAGGAATAGGAAGCTGAGAGG + Intergenic
905768476 1:40622531-40622553 GAGTGGAAGAGAAAGGTAGGAGG + Exonic
905949841 1:41940865-41940887 AGGCGGAAAGGGAAGGAGGGAGG + Intronic
906054341 1:42903166-42903188 AGTTTGAAGGGGAAGGTGGGAGG - Intergenic
906223189 1:44099293-44099315 ACCTGGAAGACTAAGGTGGGAGG + Intergenic
906468706 1:46108759-46108781 TGATGGAACAGGAAGGTGGTGGG - Intronic
906722362 1:48018190-48018212 AGGTGGCTGAGGATGGTGGCAGG + Intergenic
907124379 1:52036451-52036473 AGGAGGAAGAGGAAGAGGAGAGG + Intronic
907431821 1:54416610-54416632 AGCTTGAAGAGGACGCTGGGAGG + Intergenic
907692149 1:56679829-56679851 AGGAGGAAGAGGAAGAGGAGGGG - Intronic
907916391 1:58873637-58873659 AGGAGGAAGAGCAAGGCGTGAGG - Intergenic
907939755 1:59076180-59076202 AGATGGAGGAGGAAGGGGCGTGG + Intergenic
908495211 1:64688086-64688108 AGCAAGATGAGGAAGGTGGGAGG + Intronic
908960785 1:69694741-69694763 AGGAGGAAGAGGAAGTGGGGGGG - Intronic
909142560 1:71887236-71887258 AGGAGGAGGAGGAAGGGGAGGGG + Intronic
909585117 1:77281288-77281310 CAGTGGAGGAGAAAGGTGGGTGG - Intergenic
909862475 1:80625648-80625670 AGATGGCAGAGGATGGTAGGAGG - Intergenic
910276024 1:85449792-85449814 AGGTGGCAGATGAAGTTGGGAGG + Intronic
910297484 1:85664616-85664638 AGGTGAAGGTGGAGGGTGGGAGG + Intronic
910449193 1:87329277-87329299 AGGTGGGAGAGGGAGGGAGGGGG + Intronic
910665290 1:89719273-89719295 AAGAGGAAGAATAAGGTGGGGGG - Exonic
910789119 1:91032766-91032788 AGGAAGAAGAGGCAGGTGTGAGG + Intergenic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911031757 1:93496360-93496382 AGGTGAAAGGCGGAGGTGGGAGG - Intronic
911406681 1:97449427-97449449 AAGTGGGAGAGGGAGGTGGGAGG + Intronic
911766998 1:101689402-101689424 AGTTGGAAGAGAAAGTAGGGTGG - Intergenic
911830224 1:102541286-102541308 AGGAGCAGGAGGAAGGTAGGAGG + Intergenic
912566327 1:110590134-110590156 AGGAGCAAGAGGGAGGGGGGTGG + Intergenic
912681958 1:111734484-111734506 AGGTGGAGGTGGAGGGAGGGAGG - Intronic
912708428 1:111932107-111932129 AGGTGGAAGAGGCAGGCAAGAGG - Intronic
912854399 1:113154222-113154244 AGGAGGGAAAGGAAGGAGGGTGG + Intergenic
912993433 1:114510921-114510943 AGGAGGAGGAGGAAGGCGGCAGG - Exonic
913078004 1:115357669-115357691 AAGTGGATGGGGAAAGTGGGAGG + Intergenic
913105928 1:115613930-115613952 AGGTGGAGGCTGAGGGTGGGAGG - Intergenic
913582738 1:120243053-120243075 AGGAGAAAGAGGCAGGTGGGAGG - Intergenic
913625435 1:120655307-120655329 AGGAGAAAGAGGCAGGTGGGAGG + Intergenic
914265203 1:146032636-146032658 AAGTGGATGAGGAAGGAGTGTGG - Intergenic
914447170 1:147759907-147759929 AGGTGGAGGAGGAAAGAGTGAGG + Intronic
914564668 1:148854547-148854569 AGGAGAAAGAGGCAGGTGGGAGG - Intronic
914608158 1:149275695-149275717 AGGAGAAAGAGGCAGGTGGGAGG + Intergenic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914856651 1:151356921-151356943 ACTTGGAAGATGAAAGTGGGAGG + Intergenic
914916096 1:151820132-151820154 AGGTGGCAGGGGAAGGAGGGGGG - Intronic
914932694 1:151949235-151949257 AGGAGGAGGAGGAAGGGAGGAGG - Intergenic
915030038 1:152871223-152871245 AGTTGGAAGAGGCAGGTAGTGGG - Intergenic
915108344 1:153547915-153547937 ACTTGGGAGAGGAAGGAGGGAGG - Intronic
915248138 1:154570370-154570392 AGGTGCAATGGGAAGGTTGGGGG + Intronic
915248241 1:154570923-154570945 AGGTAGAAGGGGGTGGTGGGTGG - Intronic
915322421 1:155063090-155063112 AGGGGGAGGAGGCAGGTGCGCGG - Intergenic
915345024 1:155193017-155193039 AGGAGGAAGAGGTAGGAGGTAGG - Intergenic
915441012 1:155945531-155945553 AGGTGGGGAAGGAAGGTAGGTGG - Intergenic
915444501 1:155967043-155967065 TGAAGGAAGAGGGAGGTGGGAGG - Intronic
915479537 1:156175488-156175510 AGTGGGAAGAGGAAGGAGGAAGG - Intronic
915555847 1:156660241-156660263 AGGCGGGAGGGGAAGGGGGGTGG + Intergenic
915597208 1:156902479-156902501 AGGTGAAGGAGGAACATGGGCGG + Intronic
915935417 1:160087714-160087736 AGGTGGAGGAGGAGGGGGCGGGG + Exonic
916046676 1:161005275-161005297 AGGGGAAGGAGGAAGGAGGGAGG - Intronic
916670247 1:167011033-167011055 AAGTGAAAGAGGAAGGGGGAAGG - Intronic
916805950 1:168261344-168261366 AGATGGAAGATGAAAGGGGGAGG - Intergenic
916822172 1:168410198-168410220 GGGAGGAAGGGGAAGGTAGGTGG + Intergenic
917028180 1:170664179-170664201 AGCGGGAAGAGGGGGGTGGGTGG + Exonic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
917478108 1:175386168-175386190 TGGTGGGCGGGGAAGGTGGGAGG - Exonic
917562824 1:176177743-176177765 AGGTGGAGGGGGAAGGTAAGTGG - Intronic
917754803 1:178088431-178088453 AGGTGGCAGGGGAAGGAGGACGG + Intergenic
917941674 1:179928324-179928346 AGGAGGAAAAGGAAGGAGAGGGG - Intergenic
918023760 1:180721705-180721727 AGGAGGAAGAGTAAAATGGGAGG - Intronic
918069503 1:181124556-181124578 AGGAGGAAGAGGAACGAGGAAGG - Intergenic
918144748 1:181745647-181745669 ATGTGGATTAGGAAGGTGGCTGG - Intronic
918164849 1:181935418-181935440 GGGTGGAGGAGAAAAGTGGGGGG - Intergenic
918289314 1:183091485-183091507 AGGAGGAAGAGGAAGGGCAGAGG - Intronic
918952781 1:191160747-191160769 AGGGGGAGGGGGAGGGTGGGGGG + Intergenic
919449355 1:197751943-197751965 AGGAGGAGGAGGAAGGGGGGAGG + Intronic
919678426 1:200409735-200409757 AGGAGGAAGAGGGAAGAGGGAGG + Intronic
919925534 1:202189979-202190001 AGGTGGAGGAGAAAGCAGGGAGG + Intergenic
920003596 1:202816085-202816107 ATGTGGATGAGGAACCTGGGTGG + Intergenic
920097190 1:203493956-203493978 GGGGTGAAGCGGAAGGTGGGGGG + Intergenic
920126236 1:203695701-203695723 GGGTGGGAGATGAAAGTGGGGGG - Intronic
920260091 1:204683466-204683488 AGGGGGAGGAGGAAGAGGGGAGG + Intronic
920289896 1:204913782-204913804 AGGTTGAGGTGGGAGGTGGGAGG + Intronic
920389422 1:205589842-205589864 AGGCGCAAGAGGGAGGTGGCTGG + Intronic
920668823 1:207987330-207987352 GGGTGGAAGAGGAGGGTGTCAGG - Intergenic
920843763 1:209576566-209576588 AGGCAGAAGAGGGAGATGGGCGG + Intergenic
920926576 1:210347321-210347343 AGGTGGAAGTGGAACAGGGGAGG - Intronic
920940602 1:210478484-210478506 TGGTGAAATAGGAAGGTGAGGGG + Intronic
921012210 1:211153186-211153208 ACTTGGAAGATGGAGGTGGGAGG - Intergenic
921169038 1:212529445-212529467 AGGAGGGAGAGCAAGGAGGGAGG - Intergenic
921254034 1:213323370-213323392 AGGTGCAGGATGAAGGTGGCAGG + Intergenic
921375735 1:214471617-214471639 AGGTTAAAAATGAAGGTGGGGGG + Intronic
921396863 1:214677818-214677840 AGGAGGAGGAGGAAGGAGGGAGG - Intergenic
921790031 1:219279209-219279231 TGTGGGAAGAGGAATGTGGGTGG + Intergenic
921945403 1:220882759-220882781 AGGAGGAGGAGGAAGGAGGGAGG - Intronic
922192788 1:223333931-223333953 AGGAGGTAGGGGAATGTGGGAGG - Intronic
922574889 1:226654944-226654966 AGGAGGAAGAGGAGGGAGGAGGG + Intronic
922574922 1:226655082-226655104 AGGAGGAAGAGGAGGGCAGGAGG + Intronic
922889905 1:229053829-229053851 ATGTGGAAATGGAAGCTGGGAGG - Intergenic
923082328 1:230670043-230670065 TGCTGGACGAGGAAGGTGAGAGG + Intronic
923218601 1:231873040-231873062 CTGTGGAAGAAGATGGTGGGAGG + Intronic
923241643 1:232090793-232090815 AGGGGAAGGAGGAACGTGGGAGG - Intergenic
923529614 1:234803177-234803199 AGGGGGAAGAGGAGAGTAGGGGG - Intergenic
923728603 1:236529166-236529188 ATGAGGAAGAGTGAGGTGGGAGG + Intronic
923769688 1:236927604-236927626 AGGAGGAAGAGGAAGAGGAGGGG + Intergenic
923784561 1:237054845-237054867 AGATGAAAGAGGAAGGTGAGTGG + Intronic
924083131 1:240420294-240420316 AGATGGAAGAGGAAGGAATGTGG - Intronic
924539886 1:244970717-244970739 AGGAGAAAGAAGAAGGCGGGAGG - Exonic
924754948 1:246932094-246932116 CGGTGAAAGAAGGAGGTGGGAGG + Intergenic
924866292 1:247985244-247985266 AGGGGGTAGGGGAAGGAGGGAGG - Intronic
1062961759 10:1577644-1577666 CGGTGGGAAAGGACGGTGGGTGG + Intronic
1063039766 10:2325225-2325247 AGCAGGCAGAGGAAGGTGGACGG + Intergenic
1063057036 10:2517006-2517028 AGGAGGAGGAGGAAGATGGGAGG - Intergenic
1063159511 10:3408962-3408984 AGGAGGAGGAGGGAGGTGGAGGG + Intergenic
1063245308 10:4211743-4211765 AGGAGGAGGAGGAAGGAGAGAGG + Intergenic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1063507055 10:6609140-6609162 AGGTAGCAGAGAAAGGAGGGAGG + Intergenic
1063529703 10:6819402-6819424 AGGAGGAACAGAAAGTTGGGAGG - Intergenic
1063532816 10:6852141-6852163 AGGGGGAAGAGGAAGATTAGGGG - Intergenic
1063701023 10:8385534-8385556 AGGTGGAAGAGAAAGGGAGGAGG + Intergenic
1063770250 10:9189362-9189384 TGGTGGAAGAGGAACGGGGTTGG - Intergenic
1063777721 10:9283297-9283319 AGGTTGAAAAGGAAAGTGGCAGG - Intergenic
1063965589 10:11343804-11343826 GCCTGGAAGAGGGAGGTGGGAGG + Intergenic
1064193970 10:13230631-13230653 ATGTGCAAGAGGAGGCTGGGGGG + Intronic
1064272708 10:13879786-13879808 AGGAGGAGGAGGAAGGGAGGAGG - Intronic
1064563180 10:16612883-16612905 AGGGGGAAGAGGAGGGGGGAAGG - Intronic
1064747480 10:18492105-18492127 TGGTGCAAGAGAGAGGTGGGAGG + Intronic
1065006321 10:21383758-21383780 AAGGGCAAGAGGAAGGTGAGAGG - Intergenic
1065169193 10:23010458-23010480 AGGAGGGAAAGGAAGGAGGGAGG - Intronic
1065368010 10:24953223-24953245 AGGTGGAGGAAGATGGAGGGAGG - Intergenic
1065486397 10:26240160-26240182 TGGTGGGAGAGTAAGGTGAGTGG - Intronic
1065794197 10:29291369-29291391 AGGTGGAGGAGGAAGAGGAGGGG + Intronic
1065948359 10:30627392-30627414 AGGTGGAGGAGGAAGAGGAGGGG - Intronic
1066179210 10:32943466-32943488 AGGTGCAAGAGGAAAGGTGGGGG + Intronic
1067233622 10:44428335-44428357 AGGAGGAAGGGAAGGGTGGGAGG + Intergenic
1067297732 10:44984418-44984440 AGGTCGCAGAGGGAGGTGAGGGG - Intronic
1068478918 10:57563869-57563891 AGGTGGAATAAGATGGTGGAAGG - Intergenic
1068776370 10:60872555-60872577 AGGTGGCAGGGGAGGGCGGGAGG - Intronic
1068874580 10:61982720-61982742 AGCTGTTAGAGAAAGGTGGGAGG + Intronic
1068924075 10:62516753-62516775 GGGAGGAAGAGGAAGCAGGGTGG - Intronic
1069228392 10:65973737-65973759 AGGAGCAAGAGGGAAGTGGGAGG + Intronic
1069408311 10:68126187-68126209 AGGTTGAAGAGGTAGGTGGAAGG + Intronic
1069410004 10:68143601-68143623 GGGTGGAAGTGGAAGGAGGGAGG + Intronic
1069615103 10:69801846-69801868 AGGAGGAGGAGGAGGGAGGGGGG + Intergenic
1069615104 10:69801849-69801871 AGGAGGAGGAGGGAGGGGGGAGG + Intergenic
1069621248 10:69838582-69838604 AGGAGGAAGGGCAATGTGGGTGG - Intronic
1069657152 10:70098364-70098386 AGGTAGAGAAGGAAGGAGGGAGG + Intronic
1069858236 10:71453527-71453549 AGGTGAAAGAGGAGTCTGGGAGG + Intronic
1069884455 10:71614837-71614859 AGGTGGCAGAGGGAGAGGGGTGG + Intronic
1069966235 10:72119498-72119520 AGGTGGAACAGGATGGTTAGAGG - Intronic
1070540724 10:77413388-77413410 AGGTGAAAGAGGTTGCTGGGTGG - Intronic
1070767928 10:79067259-79067281 AGGTGGGGGAGGAAGGGTGGGGG - Intergenic
1070778658 10:79125033-79125055 AGCAGGAAGAGCAAGGTTGGAGG + Intronic
1070833206 10:79432598-79432620 AGGTGGCACAGGTAGTTGGGTGG + Exonic
1070972563 10:80579584-80579606 AGGTGGGAGTGGGAGGAGGGAGG - Intronic
1070983092 10:80665965-80665987 ATATGGAAGAGGAAGGAGTGAGG - Intergenic
1071203815 10:83251737-83251759 AGGAGGAGGAGGGAGGAGGGAGG + Intergenic
1071466279 10:85942519-85942541 AGGAAGGAGAGGAAGCTGGGTGG - Intronic
1071859941 10:89662169-89662191 AGGTGGGAGGCCAAGGTGGGTGG - Intergenic
1072148762 10:92667796-92667818 AGGAGGAAGAGGAAGAAGAGGGG + Intergenic
1072156725 10:92730518-92730540 AGGAGGAGGAGGAAGGGAGGGGG - Intergenic
1072158842 10:92747912-92747934 AGGTGGAAAGGGAAGGAGAGGGG - Intergenic
1072236196 10:93455726-93455748 AGTTGGGAGAGAAAGGTGGGTGG + Intronic
1072266344 10:93731766-93731788 AGGAGGAAGAGGAAGAAGAGGGG + Intergenic
1072383745 10:94902022-94902044 TAGTGGGAGAGGAAGGTAGGAGG + Intergenic
1072457315 10:95588101-95588123 AGTTGGAAAAGTAAGGTGTGAGG + Intergenic
1073028800 10:100508357-100508379 AGGAGGAAGATGAGGGAGGGAGG + Intronic
1073047556 10:100649610-100649632 AGCTGGAAGAGGCAGGAGGCTGG + Intergenic
1073048671 10:100654421-100654443 AGGGAGAGGAGGAAGGAGGGAGG - Intergenic
1073196364 10:101694937-101694959 AGGCGGAAGAGGAAGCGGGGCGG - Exonic
1073327494 10:102651094-102651116 AGCAGGAAGAGGAAGGAGGCTGG - Intronic
1073434229 10:103506519-103506541 AGGAGGAGGAGGAAGAAGGGAGG - Intronic
1073510802 10:104041256-104041278 AGGTGGGAGGGGGAGGTGAGAGG - Intronic
1073918805 10:108435379-108435401 AGGAGGAAGAGGAAAAAGGGAGG + Intergenic
1073943895 10:108729720-108729742 AGGTGGAGGTGGAGGGAGGGAGG + Intergenic
1073943903 10:108729740-108729762 AGGTGGAGGTGGAGGGAGGGAGG + Intergenic
1073943908 10:108729760-108729782 AGGTGGAAGTGGAGGGAGTGAGG + Intergenic
1074078738 10:110151579-110151601 AAGTGGAAGAGGAAGGAGACAGG - Intergenic
1074230711 10:111532245-111532267 GGGTGGCAGAGGTAGCTGGGAGG - Intergenic
1074423257 10:113328057-113328079 AAGGGGGAGAGGAAGGTGGGAGG - Intergenic
1074674660 10:115834724-115834746 AGGTAGTAGGGGAAGGTGTGAGG - Intronic
1074703310 10:116110834-116110856 AGGTGGTAGATGCAGGTGGTAGG - Intronic
1074716250 10:116222111-116222133 AGGGGAAAGAGCCAGGTGGGAGG + Intronic
1074878066 10:117629978-117630000 AGCAGGCAGAGGAATGTGGGAGG - Intergenic
1075066499 10:119292248-119292270 AGGAGGAAGAGGAAGAGGAGGGG - Intronic
1075079885 10:119376232-119376254 ATTTGGAAGAGGAAGGTGACTGG - Intronic
1075198620 10:120382775-120382797 AGGTGAATGAGGTGGGTGGGTGG - Intergenic
1075216946 10:120544571-120544593 AGGTGGAAGAGGGAAGAGTGAGG - Intronic
1075396367 10:122130582-122130604 AGGTGGAAGAGGAAGGAAGAGGG - Intronic
1075594766 10:123720915-123720937 TGGTGGAAGAAGATGGTGGAAGG + Intronic
1075644160 10:124086646-124086668 AGGAGGAGGAGGAAGGCAGGTGG - Intronic
1075646786 10:124102182-124102204 AGGGGGAAGAGGAATGCAGGTGG + Intergenic
1075651122 10:124128834-124128856 AGGTGCAAAGGGAAGGAGGGAGG + Intergenic
1076170950 10:128319557-128319579 ACGTGGAAGAGAAAGGATGGAGG + Intergenic
1076181476 10:128412343-128412365 AGATAGATGAGGATGGTGGGGGG + Intergenic
1076201981 10:128566363-128566385 AGGAAGAAGAGGAAGATGAGCGG + Intergenic
1076239963 10:128897336-128897358 AAGAGGAAGAGGAGGGAGGGAGG + Intergenic
1076595801 10:131623616-131623638 AGGTGGGGGAGAGAGGTGGGGGG + Intergenic
1076595866 10:131623788-131623810 AGGTGGGGGAGAGAGGTGGGGGG + Intergenic
1076595912 10:131623892-131623914 AGGTGGGGGAGAGAGGTGGGGGG + Intergenic
1076596043 10:131624224-131624246 AGGTGGGGGAGAGAGGTGGGGGG + Intergenic
1076596246 10:131624742-131624764 AGGTGGGGGAGAGAGGTGGGGGG + Intergenic
1076733601 10:132449485-132449507 AGGTGGAGGAAGGAGGTGGAAGG + Intergenic
1076795253 10:132795128-132795150 GGCTGGAAGAGGAGGCTGGGGGG - Intergenic
1076915412 10:133420986-133421008 AGAGGGAAGAGGAAGGAAGGTGG + Exonic
1076919628 10:133444919-133444941 AGGTGGCAGAGGGCAGTGGGAGG + Intergenic
1077321051 11:1942122-1942144 GAGTGGGGGAGGAAGGTGGGAGG + Intergenic
1077359447 11:2134228-2134250 AGCTGGAAGGGGAAGGTCGCTGG + Intronic
1077368768 11:2171934-2171956 GGGTGGGTGAGGAAGGAGGGAGG + Intergenic
1077392552 11:2306854-2306876 AGGGGGGAGAAGAAGGAGGGAGG + Intronic
1077491716 11:2863867-2863889 AGGAGGAGGAGGGAGGAGGGAGG + Intergenic
1077532911 11:3105685-3105707 AGGTGGGGCAGGGAGGTGGGAGG - Intronic
1077600792 11:3573114-3573136 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1077786021 11:5384278-5384300 ACTTGGAAGAATAAGGTGGGAGG - Intronic
1077840431 11:5968376-5968398 AGGAGGAAGAGGAGGCTGAGGGG + Exonic
1077988400 11:7378567-7378589 AGATGGAAGAGGGATGAGGGAGG + Intronic
1078633762 11:13030139-13030161 AGGCTGAAGAAGTAGGTGGGAGG + Intergenic
1078639969 11:13085333-13085355 AGGTGGAAGAGGAAAAGGGTGGG - Intergenic
1078801047 11:14644205-14644227 AGGTGGAAGAAGAAGCCGCGCGG - Exonic
1079132560 11:17756030-17756052 AAGTGCAAGAAGAAGGAGGGAGG + Intronic
1079320506 11:19447945-19447967 AGGAGAGAGAGGAAGGTGGGAGG - Intronic
1079365012 11:19801463-19801485 AAGAGGAAAAGGAAAGTGGGAGG - Intronic
1080050808 11:27857133-27857155 AGCTGGAAAAGGAAGGAAGGTGG - Intergenic
1080258779 11:30323201-30323223 AGGTGGAAGGGGAACGGGGGAGG + Exonic
1080868390 11:36215022-36215044 AGGTAGACGAGGTGGGTGGGGGG + Intronic
1081112736 11:39157003-39157025 TGGGGGAAGGGGAAGGGGGGAGG - Intergenic
1081296552 11:41397249-41397271 AGGTGGAAGAGGAGGCAGGAGGG - Intronic
1081423509 11:42899965-42899987 AGATGGAAAGGGAAGGTGGTTGG - Intergenic
1081655645 11:44855751-44855773 AGATGTCAGGGGAAGGTGGGTGG - Intronic
1081884118 11:46480103-46480125 AAGTGGAAGAGGAAGGCAGAAGG - Intronic
1081998210 11:47377959-47377981 AGGTAGAGGAGGGAGATGGGGGG - Intronic
1082244439 11:49905202-49905224 AGGGGGAAGGGGAAGGAGGGGGG + Intergenic
1082633412 11:55567381-55567403 GGGGGGAAGGGGGAGGTGGGAGG - Intergenic
1082667510 11:55991859-55991881 AGGGGGAGGGGGGAGGTGGGAGG + Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082791345 11:57348431-57348453 AGGAGGAGGAGGCAGGTGGGTGG - Intronic
1082795676 11:57376493-57376515 GGGTGGGAGTGGGAGGTGGGGGG - Intergenic
1082819847 11:57537506-57537528 AAGAGGGAGAGGAAGGGGGGAGG + Intergenic
1083296981 11:61720216-61720238 AGGAGAAAGAGGAAGATGGCCGG - Exonic
1083557154 11:63639508-63639530 AAGCTGAAGTGGAAGGTGGGAGG + Intronic
1083639572 11:64138212-64138234 AGGAGGAAGAGGAGGCTGGGTGG + Intronic
1083657902 11:64238573-64238595 AGTTGGAAGAGGAGACTGGGAGG + Exonic
1083674802 11:64319295-64319317 AGGAGGAAGAGGAAGGGCAGCGG - Intronic
1083699389 11:64465421-64465443 AGGTGGAAGGCTGAGGTGGGAGG - Intergenic
1083725804 11:64627389-64627411 AGGGTGCAGAGGAAGGCGGGGGG - Intronic
1083742846 11:64720325-64720347 AGATGGAGCAGCAAGGTGGGTGG + Intronic
1083951687 11:65960016-65960038 AGTTGGAGGTGGCAGGTGGGTGG + Intergenic
1084038949 11:66530609-66530631 AGGTGGAACAGGCAGGGGGTGGG + Intronic
1084040963 11:66542537-66542559 AGCAGAAAGAGGAAGATGGGTGG + Intronic
1084112738 11:67024080-67024102 AGTTGGGGGAGGGAGGTGGGGGG + Intronic
1084177974 11:67433316-67433338 TGGAGGAGGAGGAAGGTGAGAGG - Intronic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084256712 11:67947699-67947721 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1084306477 11:68287931-68287953 GGGTGGATCAGGAAGGAGGGAGG - Intergenic
1084495969 11:69503688-69503710 AGGAGGAAGAGGAGGGGTGGGGG - Intergenic
1084529297 11:69717568-69717590 AGGAGGAGGAGGGAGGCGGGAGG - Intergenic
1084571667 11:69963424-69963446 AGGAGGAGGGGGAAGGGGGGAGG + Intergenic
1084643966 11:70443643-70443665 AGGTGGAAGAGGCAGGGGCCAGG + Intergenic
1084647149 11:70465133-70465155 AGCCCGAAGAGGAGGGTGGGTGG + Intergenic
1084677928 11:70647391-70647413 AGGTGGCACAGGAGGGTGGTTGG + Intronic
1084816078 11:71647675-71647697 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1084858798 11:72005074-72005096 AGGTGGAACAGACAGCTGGGAGG - Intronic
1085087112 11:73676126-73676148 AGGAGGAAGAGGAAAGAGAGGGG + Exonic
1085165602 11:74397349-74397371 AGGTGGGGGCGGAGGGTGGGTGG + Intronic
1085502660 11:77037978-77038000 AGGGGGAAGAGGGAGGAGGAGGG + Intronic
1086167947 11:83801299-83801321 AGGGGATAGAGGAGGGTGGGAGG - Intronic
1086767180 11:90710766-90710788 GGGTGGAAGTGGGAGGTGGAGGG - Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087450647 11:98317689-98317711 AGCTGAAGGAGGAAGGTGTGAGG - Intergenic
1087578487 11:100021927-100021949 AGGAGAAAGATGAAGGTTGGAGG + Intronic
1087601981 11:100328558-100328580 AGAAGGAAGAGACAGGTGGGAGG + Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088256669 11:107909722-107909744 AGGTGGATAAGGAAGGAGGTGGG - Intronic
1088329835 11:108639865-108639887 AGAAGGAAGAGAAAGGTGGGTGG + Intergenic
1088410280 11:109526405-109526427 AGGAGGAAGAGAAAGTGGGGAGG - Intergenic
1088536600 11:110868208-110868230 AGATGGAAGAGTGAGGTGGTTGG - Intergenic
1088711152 11:112509934-112509956 AGGAGGAAGAGGATGGAAGGAGG - Intergenic
1088880879 11:113972389-113972411 AGGAGGAAAAGGAAGATCGGCGG - Intergenic
1089257303 11:117200627-117200649 AGGAGGAAGGGGAAGGATGGTGG + Intronic
1089317140 11:117599918-117599940 AGGTGGAAGAGCACAGTGGAAGG + Intronic
1089400821 11:118163639-118163661 AGGAGGAAGAGACAGATGGGGGG + Exonic
1089608598 11:119656749-119656771 AGGCGGAAGGGGAGGGTGGCAGG - Intronic
1089746907 11:120623960-120623982 AGGAGGAAGAGGGAAGGGGGAGG - Intronic
1090023960 11:123151944-123151966 AGAGGGAAGAGGAAGGAGGCAGG - Intronic
1090109553 11:123891263-123891285 AGGTGGAAGAGGAATTTGTGTGG + Intergenic
1090372801 11:126268584-126268606 AGGTGGGCGGGGAGGGTGGGAGG + Intronic
1090402852 11:126460110-126460132 AGGAGGAGGGGGAAGGGGGGAGG + Intronic
1090502944 11:127279668-127279690 AGGGGGAAGAGGAGGGGGAGGGG - Intergenic
1090620182 11:128553688-128553710 AGGAGGAGGAGGAGGGTGGCGGG - Intronic
1090833512 11:130437047-130437069 TGGTGGGAGAGGAAGGGGGGAGG + Intergenic
1090836053 11:130454799-130454821 AGATGGGGGAGGAAGGTTGGAGG + Intronic
1090851254 11:130572431-130572453 AGGTGAAAGAGGAAACTGGGAGG + Intergenic
1090990173 11:131810191-131810213 AGGTGGAGGAGAAAGGTAGGAGG - Intronic
1091057213 11:132430286-132430308 AGGGGGAAGAGGAGGGAGGTGGG + Intronic
1091358765 11:134958092-134958114 AGGTGGAAGGGGGAGCTGGCTGG - Intergenic
1091494922 12:964236-964258 ATGTTGAAAAGAAAGGTGGGGGG + Intronic
1091590542 12:1840433-1840455 ATGTGGAAGAGGGGGGTGGGTGG + Intronic
1091602069 12:1923913-1923935 TGGGGGATGAGGAAGTTGGGAGG - Intergenic
1091603110 12:1929863-1929885 AGGAGGAGGAGGAAGAGGGGAGG + Intergenic
1091663594 12:2402431-2402453 AGCTGGAAGAGGCAGGCAGGAGG + Intronic
1091676594 12:2495425-2495447 AGGTGGCAGTGGAGGGTGGGTGG + Intronic
1091776530 12:3188466-3188488 GGGTGGCAGAGGAAGGGAGGGGG + Intronic
1091969973 12:4779078-4779100 AGGGATCAGAGGAAGGTGGGAGG - Intronic
1092084960 12:5749259-5749281 AGGTGGATGAGGACACTGGGCGG - Intronic
1092426926 12:8382372-8382394 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1092527741 12:9319496-9319518 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1092621774 12:10279791-10279813 TGTTGGAAGAGGAAAGAGGGAGG - Intergenic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092803937 12:12201410-12201432 AGCTGAAATAGGAGGGTGGGAGG - Intronic
1093010043 12:14097570-14097592 AGGTGGTAGGGGAAAATGGGAGG - Intergenic
1093188128 12:16045395-16045417 AGGAGGAAGTGGAGAGTGGGAGG + Intergenic
1093363779 12:18266822-18266844 AGGAGGAGGAGGAAGAAGGGAGG - Intronic
1093375709 12:18424989-18425011 AGATGGAAGAGAAAGATGAGGGG + Intronic
1093568898 12:20643044-20643066 AGACGGAAGAGGGAGATGGGCGG + Intronic
1093870413 12:24284393-24284415 AGGTGTAAGGAGAATGTGGGAGG + Intergenic
1094078843 12:26510274-26510296 AGGAGTAAAAGGATGGTGGGTGG - Intronic
1094491237 12:30962222-30962244 AGGTGGAAGAGCCAGGTGGAAGG - Intronic
1094499988 12:31012543-31012565 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1094599750 12:31898186-31898208 AGGAGGGAGAGGAAGGGGAGTGG + Intergenic
1095200009 12:39372906-39372928 AGGTGGAATAGGGAAGAGGGAGG - Intronic
1095251848 12:39988644-39988666 AGGGAGAAAAGGAAGGAGGGAGG + Intronic
1095724246 12:45434570-45434592 GGATAGAAGAGGAAGGAGGGAGG + Intronic
1095854340 12:46843820-46843842 AGGAGGAAGAGGAAGATGCAGGG - Intergenic
1095875971 12:47080075-47080097 AGCTGGAGGAGGAAAGCGGGAGG - Intronic
1096066489 12:48744763-48744785 AGGAGGAAGAGGAAGAGGAGGGG + Intergenic
1096259383 12:50081434-50081456 TGGTGGCAGAGGCGGGTGGGCGG - Intronic
1096463600 12:51836360-51836382 ATGAGGATGAGGATGGTGGGCGG - Intergenic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097192854 12:57227747-57227769 AGGAGGCAGAGGAAGAGGGGAGG - Intergenic
1097234818 12:57532205-57532227 AGCTGCACGAGCAAGGTGGGAGG - Exonic
1097637724 12:62143179-62143201 TGGTGCAAGAGGAGGCTGGGAGG - Intronic
1097958595 12:65511154-65511176 AGGAGGAGGAGGAAAGGGGGTGG - Intergenic
1098116549 12:67184743-67184765 AGGAGGAGGAGGGAGGAGGGAGG + Intergenic
1098131739 12:67358316-67358338 AGGTAAAAGATGAAGGTGGCCGG - Intergenic
1098385135 12:69910405-69910427 AGGTGGAGGGAGAAGGTGGCAGG + Intronic
1098493555 12:71109936-71109958 AGGGGGAAGATGTAGGTGAGTGG + Intronic
1098504363 12:71232201-71232223 AGGTGGAACAGCAAGGAGGCAGG - Intronic
1098707790 12:73713322-73713344 AATGGGAAGAGGAAGGTGGTGGG - Intergenic
1099732616 12:86525255-86525277 AGGAGAGAGAGGATGGTGGGAGG - Intronic
1099734224 12:86547304-86547326 AGCAGGAAGAGGAAGGGGGGAGG - Intronic
1100165717 12:91915317-91915339 TGGAGCAACAGGAAGGTGGGTGG + Intergenic
1100332563 12:93598325-93598347 GGGTAGAAGGTGAAGGTGGGAGG + Intergenic
1100406449 12:94276463-94276485 AGGTGGAACCAGAAGGAGGGAGG + Intronic
1100429556 12:94518391-94518413 TGGTGGAAGAGGAGGTTGAGGGG - Intergenic
1100853724 12:98739908-98739930 AGGTGGTAGAGGAGGGTGCCTGG - Intronic
1101285629 12:103309262-103309284 AGGAGGAAGAGGAAGAGGAGGGG - Intronic
1101421981 12:104557704-104557726 AGGAGCAAGAGCATGGTGGGAGG + Intronic
1101680180 12:106956365-106956387 GGGCGGAGGAGGAAGGTGAGGGG + Intronic
1101901297 12:108792840-108792862 AGAGGGTAGAGGAAGGTGAGGGG + Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102349291 12:112180182-112180204 GGGTGGGAGAGGCAGGTGTGTGG + Intronic
1102394265 12:112574254-112574276 AAGAGGAAGAGGAGAGTGGGAGG + Intronic
1102394487 12:112574949-112574971 AGATGGAGGAGGGAGGAGGGTGG + Intronic
1102548673 12:113674958-113674980 AGGTGGCAGAGGGAGGCCGGAGG - Intergenic
1102568668 12:113814054-113814076 AGGGGGAAGAGGAGTCTGGGTGG + Intergenic
1102598779 12:114013008-114013030 AGGAGGGAGAGGGAGGAGGGAGG + Intergenic
1102636922 12:114332658-114332680 AGCTGGAAGTTGGAGGTGGGGGG + Intergenic
1102797147 12:115698344-115698366 AGAGGGAAGAGGAAGGGGAGTGG + Intergenic
1102866986 12:116382313-116382335 AGAAGGAAGAGGAAGGAGGAGGG + Intergenic
1102874987 12:116442339-116442361 AGGAGGAAGATGAAGGGAGGAGG + Intergenic
1102896105 12:116599768-116599790 AGGTGGAAAGGGTGGGTGGGTGG - Intergenic
1103075702 12:117980767-117980789 AGGGGGCAGGGGAAGGAGGGTGG + Intergenic
1103080940 12:118023464-118023486 AGGCGGAGGAGGAGGGTAGGGGG + Intronic
1103386483 12:120536313-120536335 ACTTGGAAGGGTAAGGTGGGAGG + Intronic
1103520459 12:121534397-121534419 GGTTGGAGGAGGGAGGTGGGAGG + Intronic
1103525155 12:121562653-121562675 AGGAGGAGGAGGAAGGGGGGAGG + Intronic
1103584791 12:121944304-121944326 AGGAGCAAGAGGAATGTTGGGGG - Intronic
1103602526 12:122063388-122063410 AGGTGGGAGAGGAAGTTAGGCGG - Intergenic
1104092945 12:125530921-125530943 AGGTATAAGAGGCAGGCGGGGGG + Intronic
1104347531 12:128014879-128014901 AGGAGGAAGAAGAAAATGGGAGG + Intergenic
1104649489 12:130521411-130521433 AGGAGGAAGAGGAGGATTGGGGG + Intronic
1104781276 12:131422094-131422116 AGGTGGAGGAGGAGGGAGGAGGG - Intergenic
1104809544 12:131612020-131612042 AGGTGGAAGGAGCGGGTGGGCGG - Intergenic
1104894725 12:132158582-132158604 AGGGCGCTGAGGAAGGTGGGTGG - Intergenic
1104952069 12:132445617-132445639 AGGCGGCGGAGGGAGGTGGGAGG - Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105435914 13:20378256-20378278 AGGTGGAAGGGGAAGGGGCCAGG - Intergenic
1105604016 13:21911951-21911973 AGGGGGCACAGGAGGGTGGGCGG - Intergenic
1105828333 13:24142647-24142669 ATGAGGAAGAGGAAAGGGGGAGG - Intronic
1106243028 13:27925270-27925292 AGGAGGAGGAGGAAGGGGAGGGG - Exonic
1106543947 13:30714569-30714591 TGGTGGAGGTGGGAGGTGGGAGG + Intronic
1106985251 13:35339732-35339754 AGGAGCAAGAGAGAGGTGGGAGG + Intronic
1107114658 13:36733881-36733903 AGGAGCAAGAGAAAGGTAGGGGG - Intergenic
1107309714 13:39063192-39063214 AGGTGGAAGAGGGAGGAAGTTGG - Intergenic
1107350260 13:39506707-39506729 AGGTGGGATAGGGAGGTGGGGGG + Intronic
1107450514 13:40504554-40504576 AGGTTGAAGAGGAAGTTGGCTGG - Intergenic
1107577523 13:41743122-41743144 ACGTGGGAGAGAAAGGTTGGTGG + Intronic
1107618015 13:42192551-42192573 AGGAGGAGGAGGAAGGGAGGAGG - Intronic
1107829569 13:44362415-44362437 AGGAGGAAGAGGAAGGGGACAGG - Intergenic
1108192768 13:47959458-47959480 AGGTGGAGGAGGAGGGGCGGAGG + Intronic
1108341745 13:49504345-49504367 AGGTGGGAGACTGAGGTGGGAGG + Intronic
1108450468 13:50557570-50557592 AGGTTGAAGAGAAAGATGAGGGG - Intronic
1109463276 13:62692210-62692232 AGGTGGATGTGGGAGGAGGGGGG + Intergenic
1109621695 13:64916753-64916775 AGGAGGAGGAGAAAGGTAGGAGG - Intergenic
1109890099 13:68600339-68600361 AGGTGGAAGAGGTGGGAGTGGGG + Intergenic
1109927085 13:69157956-69157978 AGGAGGCAGAAGAACGTGGGAGG - Intergenic
1110254118 13:73413058-73413080 ATTTGGGAGAGCAAGGTGGGAGG - Intergenic
1110515825 13:76411414-76411436 AGGAGGAGGAGAAAGGAGGGGGG + Intergenic
1112311070 13:98317975-98317997 ATGAGGAAGAGGAAGGAGAGAGG - Intronic
1112924674 13:104659573-104659595 AGGAGGAAGAGGGAGGAGGGAGG - Intergenic
1112927422 13:104693755-104693777 AGGTGGAAAAGGAAGGCAGAAGG + Intergenic
1112975184 13:105308961-105308983 AGGTGAAACAGGAAGGCTGGAGG - Intergenic
1113260427 13:108555732-108555754 AGGAGGAGGAGGGAGTTGGGAGG - Intergenic
1113319123 13:109214883-109214905 AGGAGGAAGAGAGAGGCGGGAGG + Intergenic
1113389975 13:109886138-109886160 AGGTGGAAGATGATGGAGGCAGG + Intergenic
1113616653 13:111685211-111685233 AGGTGGACATGGAAGTTGGGAGG + Intergenic
1113622183 13:111770482-111770504 AGGTGGACATGGAAGTTGGGAGG + Intergenic
1113734052 13:112664479-112664501 AGAAAGAAGAGGAAGGTGGGTGG - Intronic
1113909669 13:113836226-113836248 AGTGGGAGGAGGAAGGGGGGAGG + Intronic
1114038812 14:18656616-18656638 AGGAGGAAGAGGAAAGAGAGGGG + Intergenic
1114050917 14:18919383-18919405 AGGGGGAGGAGGAAAGAGGGTGG - Intergenic
1114111642 14:19482539-19482561 AGGGGGAGGAGGAAAGAGGGTGG + Intergenic
1114201223 14:20522579-20522601 AGGAGGAGGAGGGAGGAGGGAGG + Intergenic
1114454408 14:22845873-22845895 AGGTGGACGAGGAGGGCGGCGGG + Exonic
1114519824 14:23326051-23326073 AGTGGGAACAGGGAGGTGGGAGG + Exonic
1114587083 14:23825146-23825168 AGGTGTAAGAGGAAGCAGGAGGG + Intergenic
1114732493 14:25008258-25008280 CTGTGGGAGATGAAGGTGGGAGG + Intronic
1115111415 14:29827936-29827958 AGGTGGAAAAGAAATGAGGGAGG - Intronic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115419291 14:33174806-33174828 AGCTGGAAGAGCCAGATGGGAGG + Intronic
1115498171 14:34027192-34027214 AGGAGGAAGGGGAAGGGAGGGGG + Intronic
1115758721 14:36556573-36556595 ACGTGAAGGAGGCAGGTGGGTGG + Intergenic
1115815572 14:37160964-37160986 AGGAGAAAGAGGAAGGGGGTGGG + Intronic
1116023538 14:39489105-39489127 ATGTGTTAGAGGAAGGAGGGCGG - Intergenic
1116582788 14:46663502-46663524 GGGTGGAAGAGGGAGCTGGGTGG - Intergenic
1116974611 14:51101651-51101673 AGGTGAAAGTGGAATGTGAGAGG + Intergenic
1117359523 14:54959394-54959416 GGGGGGAAGAGGAGGGAGGGAGG + Intronic
1117484474 14:56180723-56180745 GGGCGGAAGAGGTAGATGGGGGG - Intronic
1117717770 14:58598379-58598401 AGGTGGGAGGCGAGGGTGGGAGG + Intergenic
1118077136 14:62311717-62311739 AGCTGGAAGGTGAGGGTGGGAGG + Intergenic
1118171983 14:63396335-63396357 AGGAGGAAGAGGAGGGTGGGAGG + Intronic
1118188662 14:63560416-63560438 AGGAGGGAGAGAGAGGTGGGAGG - Intergenic
1118596227 14:67437619-67437641 AGGGGGAAGAGGATGCTGGCTGG + Intergenic
1118596239 14:67437655-67437677 AGGGGGGAGAGAGAGGTGGGAGG + Intergenic
1118613759 14:67561453-67561475 AGGTGGGAGGCTAAGGTGGGAGG + Intronic
1118748294 14:68789708-68789730 GGCCGGAAGAGGAAGGTGGTCGG + Exonic
1118884972 14:69859015-69859037 AGGTGAAGGGGGCAGGTGGGAGG + Intronic
1118939879 14:70323827-70323849 AGGTAAAACAGGAAGGTTGGAGG + Intergenic
1119118180 14:72046606-72046628 AGGAGGAAGAGGAAAGGAGGGGG - Intronic
1119168517 14:72515259-72515281 TGGAGGAAGAGGAAGGGGAGGGG - Intronic
1119456880 14:74763722-74763744 AGGGGGCGGAGGAAGGTGGTGGG - Exonic
1120201170 14:81539890-81539912 TGGTTGCAGAAGAAGGTGGGAGG + Intergenic
1120470516 14:84918057-84918079 AGGAGGAGGAGGAAGGAGGAGGG - Intergenic
1120842426 14:89097517-89097539 GGGTGGAAGAGGAATGGGGTGGG - Intergenic
1121004677 14:90482454-90482476 ATGAGAAAGAGGAAAGTGGGAGG - Intergenic
1121153666 14:91663064-91663086 AGGTGGAGGAGGGAGGAGGAAGG - Intronic
1121170882 14:91853306-91853328 AGGTGAGAGAGGAAGGTGGCTGG + Intronic
1121252790 14:92512582-92512604 AGATGGAGGAGGAGGGTGTGAGG + Intergenic
1121285141 14:92729329-92729351 AGCTGGAAGAGTGAGGTGGGGGG - Intronic
1121455097 14:94033329-94033351 AGGTGGATTAGGAACGGGGGTGG - Intronic
1121550100 14:94792841-94792863 AAGAGAAAGAGGAAGGAGGGAGG + Intergenic
1121667836 14:95686278-95686300 AGGGGGAGGAGGGAGGAGGGAGG - Intergenic
1121667839 14:95686285-95686307 AGGAGGAAGGGGGAGGAGGGAGG - Intergenic
1121798918 14:96757215-96757237 AGGGGGAAGAGGATGGAGGAGGG + Intergenic
1122353803 14:101111951-101111973 AGGAGGAAGGGGAAGGAAGGAGG - Intergenic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1122811666 14:104292305-104292327 AGCTGAGAGAGGAAGGTGGAGGG + Intergenic
1122853979 14:104551448-104551470 AGGTGAAAAAGGAAGGGAGGAGG - Intronic
1123106311 14:105843374-105843396 AGGAGGAAGAGGAAGAGAGGAGG - Intergenic
1123205621 14:106710370-106710392 AGGAGAATGTGGAAGGTGGGCGG - Intergenic
1123210671 14:106757645-106757667 AGGAGAATGTGGAAGGTGGGCGG - Intergenic
1123407201 15:20028144-20028166 AGGTGGAGCAAGAGGGTGGGTGG + Intergenic
1123516531 15:21034800-21034822 AGGTGGAGCAAGAGGGTGGGTGG + Intergenic
1123795870 15:23769395-23769417 AGCAGGAAGAGGAACGTGGAAGG - Intergenic
1123800195 15:23811157-23811179 AGGCGGCAGAGGAAGGAGGGAGG + Intergenic
1123800315 15:23811957-23811979 AGAAGGAGGAGGATGGTGGGAGG + Intergenic
1124492342 15:30165751-30165773 AGGAGGAAGAGGCAGGGGAGTGG - Intergenic
1124751194 15:32372566-32372588 AGGAGGAAGAGGCAGGGGAGTGG + Intergenic
1124816749 15:33001576-33001598 AGGAGGAGGAGGATGGGGGGAGG - Intronic
1124957814 15:34371073-34371095 AGGAGGAAGAGGAGGAGGGGAGG - Intergenic
1125376508 15:39035987-39036009 GGGTGGAAGGGGGAGGGGGGAGG - Intergenic
1125447734 15:39776111-39776133 AGGAAAAAAAGGAAGGTGGGAGG + Intronic
1125584650 15:40811630-40811652 AGGAGGCAGAGGCAGGAGGGAGG + Intronic
1125768569 15:42150669-42150691 ACGTGGAAGGTAAAGGTGGGTGG + Exonic
1126050473 15:44680484-44680506 ACCTGGAAGTGCAAGGTGGGGGG - Intronic
1126270975 15:46816289-46816311 AGGGGAAAGAGGCAGTTGGGTGG + Intergenic
1126331730 15:47539664-47539686 AGTTGGGAGGCGAAGGTGGGTGG - Intronic
1126370031 15:47935790-47935812 AGGGGGAAGAGGAAGGTCAGTGG + Intergenic
1126570194 15:50142446-50142468 AGGAGGAAGTGGATGGTGAGTGG - Intronic
1126744139 15:51807823-51807845 AGGTGGAAGAAGAGGGTTGCAGG + Intronic
1127198342 15:56614930-56614952 TGGTGGAAGGGGAGGGTGGCAGG - Intergenic
1127546597 15:59999086-59999108 AGGGGGAAGAGGAGAGCGGGTGG + Intergenic
1127547427 15:60004193-60004215 AGGAGGAAGAGGAGGGGGAGCGG - Intergenic
1127905659 15:63374043-63374065 AGGTGGAGGGGGAAGGATGGAGG - Intronic
1127977969 15:64012785-64012807 AGGTTCAGGAGGATGGTGGGAGG + Intronic
1128095715 15:64953412-64953434 AGGAGGAAGAAGAAGGGAGGAGG - Intronic
1128167474 15:65478822-65478844 TGTTGGAAGCAGAAGGTGGGAGG - Intronic
1128244717 15:66125346-66125368 AGCTGGAAGAGGACTCTGGGTGG - Intronic
1128301139 15:66567095-66567117 ATGTGGAAGTGCAGGGTGGGAGG - Intergenic
1128330823 15:66754395-66754417 ACGTGCAAGTGGAAGGTGGTCGG - Intronic
1128408595 15:67369551-67369573 AGGAAGAAAAGGAAGGAGGGAGG + Intronic
1128516382 15:68344514-68344536 AGGCTGAAGAGGCAGGAGGGTGG + Intronic
1128550480 15:68595258-68595280 AGCTGGAGGAGGAAAGAGGGAGG - Intronic
1128705119 15:69832593-69832615 AAGTGGAAGAGGAAGGGGAAAGG + Intergenic
1128783357 15:70377414-70377436 GGTTGGAGGAGGAAGGTGGAGGG - Intergenic
1128826253 15:70720111-70720133 AGGAGGAAGAGAAAGAGGGGAGG - Intronic
1128840015 15:70842476-70842498 AGGAAGGAGAGGAAGGTGTGGGG - Intronic
1128992308 15:72271460-72271482 AGTTGGAAAAGGAAGGTGGTGGG + Intronic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129173274 15:73821058-73821080 AAGAGGAAGAGGAAGTGGGGAGG + Intergenic
1129731564 15:77935403-77935425 TGGTGGAAGGGGCAGGTGGGAGG + Intergenic
1129879860 15:78999362-78999384 AGCTGGAAGAGGAGGGTGCAGGG + Intronic
1130661368 15:85833756-85833778 ATGGGGAAGGGGCAGGTGGGCGG + Intergenic
1130721079 15:86386211-86386233 AGGAGGAAGGGGGAGGAGGGAGG - Intronic
1130721099 15:86386254-86386276 AGGAGGAGGAGGGAGGAGGGAGG - Intronic
1131014154 15:89043513-89043535 AGGAGGAAGAGGAGGGAGGAGGG + Intergenic
1131310781 15:91288019-91288041 AGTTGGGAGGGGAAGGTGGCTGG - Intronic
1131701280 15:94938757-94938779 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1132012900 15:98291708-98291730 AAGAGGAAGAGAAAAGTGGGTGG + Intergenic
1132053773 15:98633954-98633976 AGGAGGAGGAGGAGGGAGGGAGG - Intergenic
1132246956 15:100304843-100304865 AGGTGGAAGAGGGAGAGGAGAGG - Intronic
1132307128 15:100824450-100824472 GAGTGGATGAGGAAGGTGAGTGG - Intergenic
1132502209 16:289581-289603 AGATCGCAGAGGAAGGTGGGCGG - Exonic
1132503939 16:297524-297546 AGGTGGGAGATGAAGGTTAGGGG - Intronic
1132803153 16:1763886-1763908 GGGTGGGAGAGGACGGCGGGTGG + Intronic
1132803476 16:1765293-1765315 ATGTGGCAGTGGACGGTGGGAGG + Intronic
1132868228 16:2104221-2104243 AGGGGGATGAGGAAGATGAGGGG + Intronic
1132873566 16:2125988-2126010 GGTAGGAAGAGGATGGTGGGGGG + Intronic
1133087433 16:3375854-3375876 AGGAGGAAAGGGAAGGAGGGAGG - Intronic
1133303362 16:4796092-4796114 GGGTGGAGGCGGAAGGTGAGGGG + Intronic
1133371335 16:5247992-5248014 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1133392851 16:5423083-5423105 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133528899 16:6633904-6633926 AGGAGGCTGAGGTAGGTGGGAGG + Intronic
1133582615 16:7160827-7160849 AGGAGGAGGAGGAAGGAGGAGGG - Intronic
1133692790 16:8232738-8232760 CAGAGGCAGAGGAAGGTGGGTGG - Intergenic
1133720358 16:8488948-8488970 GGGTGGAGGAGGAAGGGAGGGGG + Intergenic
1133887839 16:9847190-9847212 AGATGGAAGAAGAATGTGTGGGG + Intronic
1133976420 16:10602388-10602410 AGGTGGAGGTGGGAGGTGGAGGG - Intergenic
1133982036 16:10640119-10640141 AGGGGGAGGAGGAAGGGGGGAGG - Intronic
1134136792 16:11681825-11681847 GGGAGGAAGAGGAAGGGGTGGGG - Intronic
1134170815 16:11968131-11968153 GGGTGGGAGAGAAAGGTGGGAGG + Intronic
1134449218 16:14353732-14353754 AGGTGGGGGAGGCAGGAGGGAGG + Intergenic
1134479279 16:14603533-14603555 TGGTGGAGGAGGAAGGGGGAAGG - Intronic
1134613739 16:15632554-15632576 AGGTGGTAGAGAGAGGAGGGAGG + Intronic
1134657307 16:15956804-15956826 AGGAGGAGGAGGAAGGGGAGGGG + Intronic
1134853548 16:17501276-17501298 TGGTGGTAGAGGAAGGTGAGTGG - Intergenic
1134892586 16:17854066-17854088 AGATGGAAGATGAGGGAGGGAGG + Intergenic
1134902912 16:17954649-17954671 AGGAGGAAGGGGAAGGGAGGTGG + Intergenic
1135539628 16:23320185-23320207 ACTTGGAAGAGTAAGGTGGCGGG + Intronic
1135992899 16:27228587-27228609 GGGTGGAAGAGGGTGGTGGCTGG - Intronic
1135992937 16:27228699-27228721 GGGTGGAAGAGGGTGGTGGCTGG - Intronic
1135992992 16:27228867-27228889 GGGTGGAAGAGGGCGGTGGCCGG - Intronic
1136013364 16:27379207-27379229 AGGTGCAAGATGAGGGTAGGGGG + Intergenic
1136197960 16:28667017-28667039 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136259027 16:29061039-29061061 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136402437 16:30025878-30025900 AGGGGAAAGAGGAAGGGCGGGGG - Intronic
1136417317 16:30112095-30112117 AGGAGGAAGAGGACGGGGGAGGG + Intronic
1136939663 16:34510984-34511006 AGGAGGAAAAGGAGGGCGGGAGG - Intergenic
1136946096 16:34652819-34652841 AGGAAGAAAAGGAAGGCGGGAGG + Intergenic
1136960157 16:34837576-34837598 AGGAGGAAAAGGAGGGCGGGAGG + Intergenic
1136968354 16:34942115-34942137 AGGAAGAAAAGGAGGGTGGGAGG + Intergenic
1136991047 16:35151612-35151634 AAGTGGACAAGGAAGGTGTGTGG - Intergenic
1137219794 16:46437374-46437396 AGGAAGAAAAGGAGGGTGGGAGG - Intergenic
1137250832 16:46739542-46739564 AGGAGGATGAGGAAGGTGAGGGG - Intronic
1137482740 16:48865824-48865846 GAGTGAAAGAGGCAGGTGGGGGG - Intergenic
1137556992 16:49477129-49477151 AGGAGGAGGAGGAGGGTGAGCGG + Intergenic
1137576530 16:49603853-49603875 TGGAGGATGAGGAAGGAGGGAGG - Intronic
1137593358 16:49707257-49707279 AGGAGCAAGAGGTAAGTGGGTGG - Intronic
1137709785 16:50558559-50558581 TGGTGGGAGAGCAATGTGGGAGG + Intronic
1137844563 16:51674579-51674601 AGCTGGAAGAGGCAGGAGGAAGG - Intergenic
1137859318 16:51830450-51830472 AGGAGGAAGAGGAGGAGGGGAGG - Intergenic
1138321782 16:56120202-56120224 AGGTTGGAGTGGAAGGTGGAAGG + Intergenic
1138373695 16:56547818-56547840 AGGGGGATGAGGAAAGTGGGAGG - Intergenic
1138649913 16:58454064-58454086 AAGTGGAAGAGGGAGGCAGGAGG - Intergenic
1138767053 16:59617377-59617399 AGGAGGCAGAGGAAGTGGGGGGG + Intergenic
1138876346 16:60955385-60955407 AGGTGGAAAAGAAAGTTTGGAGG + Intergenic
1138973048 16:62170120-62170142 AGGGGTAAGGGCAAGGTGGGAGG + Intergenic
1139542134 16:67626030-67626052 AGGTGGGAGAAGATGGTGGCTGG - Intronic
1139809954 16:69606221-69606243 ATATGGAAGGGGAAGATGGGAGG - Intronic
1139821816 16:69726869-69726891 AGGTGCAAGAGGATGCAGGGTGG + Exonic
1140266121 16:73422740-73422762 AGGTGGTAGAGGGAGTTGGGAGG - Intergenic
1140442690 16:74999485-74999507 GGGCGGAAGAGGCAGGCGGGCGG - Exonic
1140704610 16:77615041-77615063 AGGAGGAGGAGGAAGGTGCCAGG + Intergenic
1140725081 16:77804676-77804698 AGATGGAAGGGGAAGGAGAGGGG - Intronic
1140857626 16:78991740-78991762 AGATGAAACAGGAAGGTGAGGGG + Intronic
1141046943 16:80723867-80723889 AGGAGGAAGAGGAAGGGAGAAGG + Intronic
1141053910 16:80798406-80798428 AGGAGGAGGAGGAAGGGGAGGGG - Intronic
1141140266 16:81492781-81492803 ATGTGGAAGAGGAGGGGAGGCGG + Intronic
1141144273 16:81518048-81518070 AAGTGGAGGAGGGCGGTGGGTGG + Intronic
1141153242 16:81579208-81579230 AGGAGGAAGATGAAGGTGAAGGG + Intronic
1141167240 16:81668896-81668918 AGGTGGGTGTGGAAGGTGTGAGG - Intronic
1141167251 16:81668943-81668965 AGGTGGGTGTGGAAGGTGTGAGG - Intronic
1141167367 16:81669460-81669482 AGGTGGGTGTGGAAGGTGAGAGG - Intronic
1141167409 16:81669645-81669667 AGGTGGGTGTGGAAGGTGTGAGG - Intronic
1141173198 16:81704112-81704134 AGGTGAAGGAGGAGGGTGTGGGG - Intronic
1141443187 16:84042442-84042464 ATGGGGATGAGGAAGGTTGGGGG - Intronic
1141528220 16:84627094-84627116 AGGTGGAAGAAGAAGGTCTGGGG + Intergenic
1141560525 16:84864775-84864797 TGGTGGATGAGGCAGGTGGTGGG + Intronic
1141663314 16:85453279-85453301 GGGAGGTAGAGGAGGGTGGGCGG - Intergenic
1141713934 16:85716347-85716369 AGGAGGAAGAGGAGGAAGGGAGG + Intronic
1141713946 16:85716390-85716412 AGGGAGAAGAGGAAGGGAGGAGG + Intronic
1141713964 16:85716456-85716478 AGGAGGGAGAGGAAGGGAGGAGG + Intronic
1141831121 16:86510472-86510494 AGGAGGAAGAGGACGACGGGGGG - Intergenic
1141838633 16:86559869-86559891 AGGAGAAAGGGGGAGGTGGGGGG + Intergenic
1142105146 16:88298696-88298718 AGTGGGGAGAGGAAGGTGGGAGG - Intergenic
1142174484 16:88638957-88638979 TGGTGAAACAGGCAGGTGGGTGG - Intronic
1142228659 16:88889270-88889292 AGGGGGCGGAGGAAGGCGGGAGG + Intronic
1142475021 17:183537-183559 AGGAGGAAGAGGAGGACGGGAGG + Intergenic
1142477711 17:199421-199443 AGATTCAAGAGGAAGCTGGGAGG + Intergenic
1142621636 17:1169100-1169122 AGGGGAAAGAGGAGGGAGGGAGG + Intronic
1142683641 17:1564174-1564196 AGGTGGACTAGGACAGTGGGAGG + Intergenic
1142825721 17:2508963-2508985 AGGTGAAAGGCGATGGTGGGAGG - Intronic
1142887892 17:2924573-2924595 AGGTGGAAGATGGAGGAGAGAGG + Intronic
1142958221 17:3535380-3535402 AGGAGGGAGAGGGAGGAGGGAGG - Intronic
1143036296 17:4001163-4001185 AGGAGGAAGAGGCAGGATGGAGG + Intergenic
1143202468 17:5122347-5122369 AGGGTGAAGAGCAAGGTGGGTGG + Intronic
1143273579 17:5693563-5693585 AGGTGGGAGGGGAAGGGAGGAGG + Intergenic
1143391263 17:6560650-6560672 AGGAGGAAGAGGAGGAGGGGAGG - Intergenic
1143391311 17:6560885-6560907 AGGAGGAAGAGGAGGGGCGGAGG - Intergenic
1143391347 17:6561024-6561046 AGGAGGAAGAGGAAGGGAGAAGG - Intergenic
1143391362 17:6561085-6561107 AGGAGGAAGAGGAAGGGAGAAGG - Intergenic
1143391373 17:6561121-6561143 AGGAGGAAGAGGAGGGAAGGAGG - Intergenic
1143391382 17:6561153-6561175 AGGAAGAGGAGGAAGGGGGGAGG - Intergenic
1143391383 17:6561156-6561178 AGGAGGAAGAGGAGGAAGGGGGG - Intergenic
1143391392 17:6561179-6561201 AGGAGGAAGAGGAGGGGGAGGGG - Intergenic
1143391402 17:6561202-6561224 AGGAGGAAGAGGAGGGGGAGGGG - Intergenic
1143391465 17:6561429-6561451 AGGAGGAAGAGGAAGGGAGAAGG - Intergenic
1143391504 17:6561571-6561593 AGGAGGAAGAGGAGGGAAGGAGG - Intergenic
1143391514 17:6561602-6561624 AGGAGGAAGAGGAGGGAAGGAGG - Intergenic
1143391528 17:6561654-6561676 AGGAGGAAGAGGAGGGGGAGGGG - Intergenic
1143391550 17:6561717-6561739 AGGAGGAAGAGGCAGAAGGGAGG - Intergenic
1143635090 17:8159829-8159851 AGGTGGATCAGGCAGATGGGAGG + Exonic
1143702572 17:8672204-8672226 AGGAGGAAGAGGAAGAGGAGGGG + Intergenic
1143750371 17:9022683-9022705 AGGTCGGTGAGGAAGGCGGGCGG - Exonic
1143845898 17:9772511-9772533 AGGTGGCAGAGGAAGCTGAGTGG + Intronic
1143855417 17:9844453-9844475 GGGTGGAAGAAGAGGGAGGGTGG + Intronic
1143919583 17:10320426-10320448 AGGGCGAAGAGGAAGCTGGAAGG - Exonic
1144052434 17:11508563-11508585 AGGTGGGAAAGGAAGGGGAGGGG - Intronic
1144067652 17:11639076-11639098 AGGAGGAAGAGGACCCTGGGTGG - Intronic
1144143675 17:12376370-12376392 AGGGGGAGGAGGGAGGGGGGAGG + Intergenic
1144580442 17:16456084-16456106 AGGAGGAGGAGGAAGGGGAGGGG + Intronic
1144626905 17:16848592-16848614 AGGGTGAAGAGCATGGTGGGTGG - Intergenic
1144687628 17:17236833-17236855 AGGTGGACGAGTAATGGGGGAGG - Intronic
1144726394 17:17504671-17504693 AGGTGGAAGAGGAGAGGGGCTGG + Intergenic
1144826239 17:18107259-18107281 AGGGAGACGAGGCAGGTGGGCGG - Exonic
1144879534 17:18424120-18424142 AGGGTGAAGAGCATGGTGGGTGG + Intergenic
1145102975 17:20092066-20092088 AAGTAGAAGAGAAAGGAGGGAGG - Intronic
1145152706 17:20520267-20520289 AGGGTGAAGAGCATGGTGGGTGG - Intergenic
1145911573 17:28546382-28546404 GGGTGCAAGGGGAAGGTGTGGGG - Intronic
1146164041 17:30574431-30574453 AGGGTGAAGAGCAAGGTGGGTGG - Intergenic
1146180100 17:30692552-30692574 AGGAGGAAGAGGAAGAAGAGGGG - Intergenic
1146320548 17:31843266-31843288 GGGTGGAATAGGAAGGCAGGAGG - Intergenic
1146454571 17:32998916-32998938 AGGTGGAGGAGGATGGTGGGGGG - Intergenic
1146581311 17:34040448-34040470 GAGGGGACGAGGAAGGTGGGGGG + Intronic
1146609393 17:34290961-34290983 ACTTGCAAGAGGAAGGTTGGTGG + Intergenic
1146621602 17:34402667-34402689 AGCTGTAAAAGGATGGTGGGGGG + Intergenic
1146688501 17:34857187-34857209 AGGTGGGAGAGGATGCAGGGTGG + Intergenic
1146693712 17:34893443-34893465 AAGTGGAGGATGGAGGTGGGAGG - Intergenic
1146701760 17:34967145-34967167 AGGTGGAAGGCCAAGGTTGGAGG - Intronic
1146950038 17:36899624-36899646 AGCTGGGAGAGGAAGGGGAGAGG + Intergenic
1147210717 17:38870977-38870999 GGGTGGCAGAGTAGGGTGGGTGG + Intronic
1147363592 17:39946154-39946176 AGGGGCAAGGGGAAGGTGGGTGG + Intergenic
1147967287 17:44200002-44200024 AGAAGGAAGAGGAAGGGAGGGGG - Intronic
1148377065 17:47158194-47158216 ATGTGAAATAGGTAGGTGGGTGG - Exonic
1148444794 17:47731040-47731062 TGGAGGAAGAGGAAGGCTGGGGG - Intergenic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148645404 17:49217375-49217397 AGGTGGCAGAGAATGGTGGCTGG - Intronic
1148680308 17:49469984-49470006 GGGTGGACGGGGCAGGTGGGAGG + Intronic
1148789051 17:50162967-50162989 AGAAGGAAGAAGAAGGAGGGAGG + Intergenic
1148789059 17:50162997-50163019 AGAAGGAAGAAGAAGGAGGGAGG + Intergenic
1148848862 17:50544658-50544680 AGGAGGAAGAGGAAAGGGAGGGG - Intronic
1149387521 17:56156629-56156651 AGGTGGAAAAGGAAGGAGTAAGG + Intronic
1149388292 17:56164150-56164172 GGGTGGAAAAGCAAGGTGAGTGG - Intronic
1149628197 17:58095420-58095442 AGCTGGAAGACAGAGGTGGGAGG - Exonic
1150108443 17:62478688-62478710 GAGGGGACGAGGAAGGTGGGGGG - Intronic
1150249046 17:63696118-63696140 GGGTGGAAGGGGCAGGAGGGTGG - Exonic
1150330212 17:64288187-64288209 AGGAGGAAGAGGGAGGAGGGAGG + Intergenic
1150466120 17:65394106-65394128 AGAAGGTAGAGGAAGGTGGTGGG + Intergenic
1150475832 17:65473994-65474016 AGGAGGAAGAGGAAGGGGAAGGG - Intergenic
1150491923 17:65580247-65580269 AGGCGGAAGGGGGAAGTGGGTGG - Intronic
1150767469 17:68013585-68013607 AGGAAGAAGAGGAAGGGGAGAGG + Intergenic
1150919593 17:69469254-69469276 AAGTGGAAGAGGAAGGTAGAGGG - Intronic
1151145564 17:72037337-72037359 AGGAGGAAGAGGAAGAGGAGGGG - Intergenic
1151155776 17:72122302-72122324 AGGTGGGAGTGTATGGTGGGGGG + Intronic
1151351380 17:73534073-73534095 AGGAGGAAGAGGAGGGGAGGAGG - Intronic
1151477689 17:74353169-74353191 AGTTGGCAGAGGAAGATGAGTGG - Intronic
1151808734 17:76423157-76423179 AGGAGGAAGAGGTAGGTGAGGGG + Intronic
1151825000 17:76519238-76519260 AGGTGGAGGAAGGATGTGGGGGG - Intergenic
1152000071 17:77639872-77639894 AGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1152100809 17:78300883-78300905 TGGGGGAACAGGAAGGTGGAGGG - Intergenic
1152124554 17:78438435-78438457 AGGAGGAGGAGGGAGGAGGGAGG + Intronic
1152245630 17:79183268-79183290 TGGAGGTAGAGGAAGGCGGGCGG + Intronic
1152313683 17:79567055-79567077 AACGGGAAGAGGAAGATGGGAGG - Intergenic
1152315951 17:79580275-79580297 AGGAGGAGGAGGAGGATGGGGGG - Intergenic
1152334738 17:79694215-79694237 AAGTGGAAGACGGAGGCGGGAGG + Intergenic
1152335114 17:79696217-79696239 AGGGTGAAGAGCAAGGCGGGAGG + Intergenic
1152336641 17:79702872-79702894 AGGAGGAGGAGGAAGAGGGGAGG - Intergenic
1152356651 17:79810801-79810823 AGGTGGCGGAGGGGGGTGGGGGG - Intergenic
1152390896 17:80003108-80003130 AAGGGCAAGAGGAAAGTGGGAGG + Intronic
1152409678 17:80117158-80117180 GGGTGGAGGGGGCAGGTGGGAGG - Intergenic
1152457183 17:80423203-80423225 CGAGGGAAGAGGAAGCTGGGAGG + Intronic
1152471727 17:80493238-80493260 AGGAGAGAGAGGAAGGTGAGGGG + Intergenic
1152557731 17:81062834-81062856 AGCTGGAAGACGACGGTGTGAGG - Intronic
1152683822 17:81683987-81684009 AGGCGGAAGCGGAAGTCGGGGGG + Exonic
1152778547 17:82216418-82216440 CTGTGGCAGAGCAAGGTGGGTGG + Intergenic
1152793822 17:82296930-82296952 AGGAGGAAGAGGAGGCTGAGGGG - Intergenic
1152838042 17:82547750-82547772 AGGGGCAAGAGGAAGGTTTGGGG - Intronic
1153443363 18:5145820-5145842 AGGTAGAGGAGAAAGATGGGAGG + Intronic
1153666462 18:7371051-7371073 TGGAGGAAGAGGAAGGGGCGCGG + Intergenic
1153782594 18:8507196-8507218 AGGGGGAAGAGGAGGGTGTTGGG + Intergenic
1153824990 18:8866918-8866940 GGGTGCAAGAGGTAGGTGGCAGG - Intergenic
1153991801 18:10406818-10406840 TGATGGAAGAGGCAGGAGGGAGG - Intergenic
1154111213 18:11570136-11570158 AGGGGGAATGGGGAGGTGGGCGG - Intergenic
1154111936 18:11577692-11577714 AAGGGGAAGGGGAAGGTGGGAGG + Intergenic
1154207300 18:12348066-12348088 AGGTGGCAGGGGACGGTGGCAGG + Intronic
1154308985 18:13253193-13253215 AGGTGACAGGAGAAGGTGGGAGG + Intronic
1154324553 18:13380440-13380462 AGGTTGAAGATGAGTGTGGGAGG - Intronic
1154496201 18:14963147-14963169 AGGTGGAAGGGGGAGCTGGCTGG + Intergenic
1155507592 18:26548285-26548307 AGGAGGAGGACGGAGGTGGGGGG - Intronic
1156149113 18:34222856-34222878 AGGGGGTTGAGGAAGGTAGGGGG + Intronic
1156190238 18:34710574-34710596 AGGTGGAGGAGCTAGGAGGGTGG - Intronic
1157314777 18:46578422-46578444 AGGCTGGAGAGAAAGGTGGGTGG + Intronic
1157338471 18:46757752-46757774 AGGGGGAAGAGGACTGTGGCGGG - Intronic
1157442534 18:47721729-47721751 AGGAGGAAGAGGAGAGTGTGGGG + Intergenic
1157478229 18:48036777-48036799 AGGTGGAAGGGGCAGGTGTTAGG + Intronic
1157543188 18:48526872-48526894 AGGTGAAATGGGAAGATGGGAGG + Intergenic
1157564213 18:48668742-48668764 AGGGGCAGGAGGAAGGTGAGAGG - Intronic
1157605669 18:48924434-48924456 TGGGGGCAGAGGAAGCTGGGTGG + Intronic
1157618755 18:49003289-49003311 AGGAGGACGAGGAAGAAGGGAGG - Intergenic
1157690630 18:49678934-49678956 ACGTGGGAGAGGAAGGGGAGGGG + Intergenic
1158414172 18:57234660-57234682 ATGAGGAAAAGAAAGGTGGGAGG + Intergenic
1158442484 18:57489192-57489214 AGGATGCAGAGGATGGTGGGAGG - Exonic
1158493317 18:57929871-57929893 AAGTGGCACAAGAAGGTGGGTGG - Intergenic
1158566238 18:58556567-58556589 AGCTGGTGGAGGAAGGTGGGAGG + Intronic
1158681237 18:59568925-59568947 AGGTGGAGGTGGCAGGTGGGAGG - Intronic
1158748181 18:60226549-60226571 AGGTGGCATATGCAGGTGGGTGG + Intergenic
1158851029 18:61496011-61496033 AGGTGGGAGAGGAAGGGTGGAGG - Intronic
1158851090 18:61496185-61496207 AGGGGGGAGAGGAAGGGAGGAGG - Intronic
1158938214 18:62384409-62384431 TGGAGGAAGAGGAAGGAGAGAGG - Intronic
1159198702 18:65153781-65153803 AGGAGGAGGAGGAGGATGGGGGG - Intergenic
1159310196 18:66698107-66698129 AGGAGGCTGAGGAAGGAGGGTGG + Intergenic
1159482781 18:69012151-69012173 TGGTGGAAGAGTAAGTTGGAAGG + Intronic
1159508814 18:69369370-69369392 GGGTATCAGAGGAAGGTGGGGGG + Intergenic
1159586659 18:70288987-70289009 AGGAGGAGGAGGAAGGAGGCGGG + Exonic
1160018116 18:75159308-75159330 AGGCGGCAGAAGAAGGAGGGTGG + Intergenic
1160106872 18:75986645-75986667 TGGTGGATGAGGAAGGCGTGTGG + Intergenic
1160322061 18:77905518-77905540 AGGTGGAAGGGGAGGGAAGGGGG + Intergenic
1160680460 19:409635-409657 CTGTAGATGAGGAAGGTGGGGGG + Intergenic
1160872203 19:1282549-1282571 AGGAGGGGGAGGAGGGTGGGAGG + Intergenic
1160965665 19:1746010-1746032 AGGAGGAGGGGGAAGGAGGGGGG + Intergenic
1161229405 19:3165545-3165567 AGAGGTAAGAGGAAGCTGGGTGG - Intergenic
1161243561 19:3236261-3236283 AGGTGGAGGAGGAAGTGGAGAGG + Intronic
1161264238 19:3356656-3356678 AGGTGGGAGACTGAGGTGGGTGG - Intergenic
1161339699 19:3734468-3734490 GGGAGGGAGAGGGAGGTGGGAGG + Intronic
1161473260 19:4471978-4472000 AGGTGAAAGGGAAAGGTGGGAGG - Intergenic
1161509542 19:4662912-4662934 AGGAGGAGGAGGAAGGTGCTGGG - Intronic
1161638139 19:5402024-5402046 AGGAGGAAGAGAAGGGAGGGAGG + Intergenic
1161707190 19:5827719-5827741 GGGAGGAAGAGAAAGGAGGGGGG - Intronic
1161853900 19:6753063-6753085 AGGTTGTCGGGGAAGGTGGGGGG + Intronic
1161911912 19:7200220-7200242 AGATGGATGAGGAAGTTGAGAGG + Intronic
1161981219 19:7631434-7631456 GGGTGGGACAGGAAGGGGGGAGG - Intronic
1161989036 19:7673500-7673522 ATGAGGAGGAGGAAGGAGGGAGG - Intergenic
1161989973 19:7679002-7679024 AGGAGGTGGAGGAGGGTGGGTGG + Intronic
1162024208 19:7884556-7884578 AGGGGGAGGAGGAAGATGGGAGG + Intergenic
1162034391 19:7931466-7931488 TGGAGGAAGAGAAAGGTGGCTGG + Intronic
1162034529 19:7931950-7931972 AGGAGGAAGAGGACGTTGGGCGG + Intronic
1162183882 19:8889545-8889567 AGGAGGGAGAGGGAGGTGAGTGG + Intronic
1162428994 19:10615617-10615639 AAGAGGAAGAGGAAGGGGAGGGG + Intronic
1162464983 19:10834547-10834569 AGGTGGAAGTTGAACCTGGGAGG - Intronic
1162561701 19:11421228-11421250 AAGCGAGAGAGGAAGGTGGGCGG + Intronic
1162743406 19:12786145-12786167 AGGTGGGAGAGGGAGGCGGCTGG + Intronic
1162791425 19:13065074-13065096 AGGAGGAGGAAGGAGGTGGGTGG - Intronic
1162925109 19:13926944-13926966 AGGAGGGAGAGGAAGTTGGGTGG - Intronic
1162978499 19:14223002-14223024 AGGAGGAAGAGGAAGAAGAGGGG + Intergenic
1163034984 19:14564929-14564951 AGGCTGAAGAGGAAGCAGGGAGG - Exonic
1163061218 19:14763707-14763729 AGGAGGCAGAGGAAGATAGGAGG - Intronic
1163153032 19:15425839-15425861 AGGAGGAGGAGGGAGGAGGGAGG + Intronic
1163198677 19:15746046-15746068 ACGTGGAGGAGGAAGGGGAGGGG - Intergenic
1163511106 19:17735575-17735597 AGGTGGAAGTGGGAGGTGGCTGG - Intergenic
1163668444 19:18613812-18613834 AGGGGCAGGAGGAGGGTGGGGGG - Intronic
1163696366 19:18765527-18765549 AGGTGCGAGGGCAAGGTGGGGGG + Exonic
1163838613 19:19592050-19592072 GGGTGGGTGAGGGAGGTGGGGGG + Intronic
1163995310 19:21040079-21040101 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164001905 19:21108180-21108202 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164234899 19:23323363-23323385 AGGAGGAAGAGGAAGGGAAGAGG - Intronic
1164441857 19:28285001-28285023 AGGATGGAGAGAAAGGTGGGTGG + Intergenic
1164522085 19:28987376-28987398 AGGAGGAAGAGGAAGAAGAGAGG - Intergenic
1164560382 19:29287946-29287968 AGGTAGAAAGGGAAGGAGGGAGG + Intergenic
1164592030 19:29512506-29512528 AGGATGAGGAGGAAGGAGGGGGG + Intergenic
1164642032 19:29833120-29833142 AGTTGGGAGAGGGAGGGGGGTGG - Intergenic
1164680544 19:30131170-30131192 AGGGGGAAGGGGAAAGAGGGAGG - Intergenic
1165135604 19:33666500-33666522 AGAAGGAACCGGAAGGTGGGAGG + Intronic
1165365370 19:35361962-35361984 AGGTGGGAGAAGACTGTGGGGGG + Intergenic
1165439250 19:35815088-35815110 AGGTGGAGGTGGTGGGTGGGGGG - Intergenic
1165610390 19:37146584-37146606 AGGAGCAAGAGGAATGTGGCAGG - Intronic
1165690890 19:37862389-37862411 AGGAGGAGGAGGAAGGAGGAGGG + Intergenic
1165690922 19:37862548-37862570 AGGAGGAAGAGGAGGAGGGGTGG + Intergenic
1165811641 19:38615235-38615257 AGGGGGAGGAGGAAAGTGGGAGG + Intronic
1165920872 19:39297226-39297248 AGGTGACAGAGGCAGGTGAGAGG - Intronic
1166147774 19:40849218-40849240 TGGAGGAAGAGGATGGAGGGAGG + Intronic
1166151910 19:40880989-40881011 TGGAGGAAGAGGATGGAGGGAGG + Intronic
1166160226 19:40947218-40947240 AGGAGGAAAAGGAAGGCGGAGGG + Intergenic
1166257581 19:41617600-41617622 AAGTGAGAGAGGGAGGTGGGAGG + Intronic
1166273306 19:41732472-41732494 AAGTGAAAGAGGAAGGCAGGAGG - Intronic
1166278376 19:41772297-41772319 AAGTGAAAGAGGAAGGCAGGAGG - Intergenic
1166297802 19:41897316-41897338 AGGTGGAAGAGGTGGGTGCCTGG + Intronic
1166330600 19:42076118-42076140 CGGCCGAGGAGGAAGGTGGGAGG + Intronic
1166351250 19:42199459-42199481 TGATGGAGGAGGAAGGGGGGCGG - Exonic
1166361393 19:42254251-42254273 AGGAGGGTGGGGAAGGTGGGGGG - Intronic
1166388421 19:42395409-42395431 AGATTGAAAGGGAAGGTGGGAGG + Intergenic
1166400197 19:42473072-42473094 AGGTTGGAGAGGAAGGTGGAGGG + Intergenic
1166677252 19:44747677-44747699 AGGTGGGAGGGGAAGTCGGGGGG + Intergenic
1166746802 19:45145603-45145625 AGGAGGAAGAGGAAGGGGAGAGG + Exonic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
1167019510 19:46862946-46862968 AGCTCCAAGAGGAAGGTGGGGGG - Intergenic
1167056066 19:47112355-47112377 AGGAGGAGGAGGAAGGGGGGCGG - Intronic
1167072263 19:47228062-47228084 AAGTGGGAGAGGACGGGGGGAGG - Intronic
1167117230 19:47495411-47495433 AGGGGGAAGTGGGAGCTGGGGGG - Intronic
1167134498 19:47608847-47608869 AGGAGGAGGAGGAAGGGGGTGGG + Intronic
1167568563 19:50272411-50272433 AGATAGATGGGGAAGGTGGGAGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167708225 19:51094380-51094402 AGGTGGAGGAGAGAGGTGAGAGG - Intergenic
1167775633 19:51552979-51553001 AGGAGGAAGAGGAGGGGGGGAGG + Intergenic
1167955108 19:53058038-53058060 ACGAGGAGGAGGGAGGTGGGGGG + Intergenic
1167960760 19:53102903-53102925 ACGAGGAGGAGGGAGGTGGGGGG + Intronic
1167971871 19:53192852-53192874 ACGAGGAGGAGGGAGGTGGGGGG + Intronic
1168037115 19:53728801-53728823 AGGCTGAAGTGGGAGGTGGGAGG - Intergenic
1168078064 19:53991469-53991491 AAGGGGACGAGGAAGGGGGGAGG - Intergenic
1168097019 19:54121767-54121789 AGGCGGAGGATGAAGTTGGGAGG - Intronic
1168316869 19:55488395-55488417 AGGCGGCAGGGGACGGTGGGGGG - Intronic
1168414608 19:56160298-56160320 AGGTGGAGGAGGACGATGGGAGG - Exonic
1168433802 19:56302313-56302335 AGGAGGAAGGGGAGGGAGGGAGG - Intronic
1168433870 19:56302556-56302578 AGGAAGAAAAGGAAGGGGGGAGG - Intronic
1168695074 19:58399697-58399719 AAGTGAAAGAGGGAGGTAGGAGG - Intergenic
925004321 2:429281-429303 AGGAGGAAGAGCAAGAAGGGAGG - Intergenic
925200978 2:1967709-1967731 GGGTGGAAGAGGATGGGGGGAGG + Intronic
925351149 2:3201395-3201417 GAGTGAAATAGGAAGGTGGGAGG - Intronic
925674766 2:6350385-6350407 AGGTGGAAGAGGAAGAGAGCAGG - Intergenic
926148190 2:10409654-10409676 GGGTGGAACAGGAAGGTGGAAGG - Intronic
926208277 2:10849411-10849433 AGGAGGAAGAGGGTGGGGGGTGG + Intronic
926240463 2:11081130-11081152 AGGGGGAAGGGGGAGGGGGGAGG - Intergenic
926373431 2:12203578-12203600 TGCTGGAATAGGATGGTGGGGGG + Intergenic
926474387 2:13304118-13304140 AGATGGAACAGTAAGGTAGGAGG - Intergenic
926698356 2:15785957-15785979 AGGCCGTAGAGCAAGGTGGGTGG + Intergenic
926884186 2:17582228-17582250 AGGGGAAGGAGGAAGGTGGGAGG + Intronic
927056793 2:19372992-19373014 AAGGGGAAGAAGAAGGTGGTTGG - Intergenic
927187348 2:20491306-20491328 AGGAGGAGGAGGGAGGGGGGAGG - Intergenic
927187349 2:20491309-20491331 AGGAGGAGGAGGAGGGAGGGGGG - Intergenic
927684225 2:25159727-25159749 AAATGGCAGGGGAAGGTGGGGGG + Intergenic
927868652 2:26609302-26609324 AGGGGGAAGAGGAAGGGGAGAGG + Intronic
928122384 2:28592363-28592385 AGGAAGAAGGGAAAGGTGGGAGG - Intronic
928427640 2:31192259-31192281 AGGTGGAAGAGCAAGGTGGGAGG - Intronic
928588749 2:32791371-32791393 ATGTGGAAGAGGAAGGAAAGGGG + Intronic
928896281 2:36267386-36267408 AGGAGGAAGAGGAAGAGGGGAGG + Intergenic
929092093 2:38228932-38228954 AGGAGGGAGAAGAAGGAGGGAGG + Intergenic
929303939 2:40338094-40338116 AGGGAGAAGAGGGAGATGGGAGG - Intronic
929504901 2:42520860-42520882 AGGTGGAAGAGGAACCAGGCTGG - Intronic
930073457 2:47388017-47388039 AGGTGGAGGAGGTAGAAGGGAGG + Intergenic
930231905 2:48851848-48851870 AGGTGGAAGAGGGAAATGGAAGG - Intergenic
930358807 2:50352228-50352250 AGATGGAAGAGGAGAGTGAGTGG + Intronic
930364632 2:50424130-50424152 AGGAGGAGGAGGAGGGGGGGAGG + Intronic
930629162 2:53733683-53733705 AGGTGGGAGGCCAAGGTGGGCGG - Intronic
930717786 2:54609011-54609033 AGGCTGAGGAGGAAGGTGGGGGG + Intronic
930826374 2:55700413-55700435 AGGAAGAAAGGGAAGGTGGGAGG - Intergenic
930852513 2:55975622-55975644 GGTGGGAAGAGGAGGGTGGGGGG + Intergenic
931331327 2:61287543-61287565 AAGAGGAGGAGGAAGGTGAGGGG - Intronic
931482522 2:62656190-62656212 ATGGGGAACAGGAAGGTTGGTGG - Intergenic
931759797 2:65406615-65406637 GGGTGGAAATGGAAGGTTGGGGG + Intronic
931790258 2:65658356-65658378 AAAGGGCAGAGGAAGGTGGGGGG + Intergenic
932303556 2:70685811-70685833 GGGAGGAAGAGGGAGGTGGGAGG - Intronic
932356684 2:71073318-71073340 GGGTGGGAGAGGGGGGTGGGAGG - Intronic
932413228 2:71559388-71559410 GGGTGGGAGAGGAAGGAAGGAGG - Intronic
932446831 2:71786696-71786718 AGGCGGAATGGTAAGGTGGGGGG - Intergenic
932488307 2:72101050-72101072 ATGTTGAAGAGCAAGGTGGATGG - Intergenic
932570577 2:72936364-72936386 AGGTGTGGAAGGAAGGTGGGAGG + Intergenic
932575348 2:72959625-72959647 AGGTGGAAGAGGAGTGGGGTGGG - Intronic
932635630 2:73385821-73385843 AGGAGGAGGAGGAGGGGGGGAGG - Exonic
932713122 2:74082319-74082341 GGCTGGAAGAGGAAGGCAGGAGG + Intronic
932755649 2:74407436-74407458 ATTTGGGAGTGGAAGGTGGGAGG - Intergenic
932781449 2:74561048-74561070 AGGTGGAGGAGGAGGGGAGGAGG + Intronic
933174319 2:79158773-79158795 AGGTGGAAGAAGAGGGGGGAGGG + Intronic
933803699 2:85982841-85982863 ACGTGGGAGAGGACTGTGGGTGG - Intergenic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
934025684 2:88000019-88000041 AGCTGGAATAAGGAGGTGGGGGG - Intergenic
934492683 2:94772510-94772532 GGGTGAAAGATGAGGGTGGGGGG - Intergenic
934551743 2:95267093-95267115 CGGTGGACGTGGAAGGTGGGGGG + Intergenic
934652365 2:96099868-96099890 AAGGGGAAGAGGAAGGGGAGGGG + Intergenic
934883488 2:98004681-98004703 AGGAGGAGGAGGAGGGAGGGAGG - Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
934979956 2:98831473-98831495 AGGTGACAGGGGAAGGTGTGTGG + Intronic
935110747 2:100092203-100092225 AGGAGGAAGAGCAAGCTGAGTGG - Intronic
935123242 2:100200001-100200023 AGGAGGAAGAGGGAGGAAGGAGG - Intergenic
935277180 2:101485093-101485115 AGAATGAAGAGGAAGATGGGGGG - Intergenic
935600831 2:104919811-104919833 AGGGGGAAGAGGAAGAGGAGAGG - Intergenic
935636880 2:105255868-105255890 AGGAGGCAGAGGAAGGGGTGGGG - Intergenic
936061949 2:109300646-109300668 AGAAGGAAGAGGAAGATGGATGG - Intronic
936061954 2:109300673-109300695 AGGAGGAAGAGGAAGGTGGTTGG - Intronic
936124224 2:109772959-109772981 AGGAGGAAGAGCAAGCTGAGTGG + Intergenic
936127937 2:109807350-109807372 AGGTGGAAGAATAAGAAGGGTGG + Intronic
936216760 2:110564135-110564157 AGGTGGAAGAATAAGAAGGGTGG - Intronic
936220464 2:110598505-110598527 AGGAGGAAGAGCAAGCTGAGTGG - Intergenic
936379385 2:111970685-111970707 AGGTGGAAGGAGGAGGAGGGAGG - Intronic
936395561 2:112125630-112125652 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
936425899 2:112418716-112418738 AGGTGGAAGAATAAGAAGGGTGG - Intronic
936485256 2:112919899-112919921 ATGTGAAAGAGGAAGGCAGGAGG - Intergenic
936523250 2:113225786-113225808 AGGCGGCAGGGGAAGGTGGAGGG + Intronic
936780882 2:116030757-116030779 AGGGGGAAAAGGAAGGAGGGAGG - Intergenic
937305288 2:120867146-120867168 AAGAGGAAGAGGAAGCTGGGTGG - Intronic
937357705 2:121208778-121208800 AGATGAAGGAGGAAGGTGGAAGG + Intergenic
937777536 2:125797312-125797334 AGGGGGAAGAGGAGGGGGAGGGG + Intergenic
937872089 2:126793177-126793199 AGGCTGCAGAGGGAGGTGGGCGG + Intergenic
937953745 2:127407998-127408020 AGGGGGAAGAGGAGGGGGCGGGG - Intergenic
937972968 2:127564544-127564566 AGGTGGGTGAGGAAGGTGTGTGG + Intronic
937975537 2:127580249-127580271 AGGAGGAACTGGAAGCTGGGAGG + Intronic
938164455 2:129014589-129014611 AGCTGAATGAGGAAGCTGGGAGG - Intergenic
938272154 2:129982486-129982508 AGGAGGAAGAGGAAAGAGAGGGG - Exonic
938443858 2:131361340-131361362 AGGAGGAAGAGGAAAGAGAGGGG + Intergenic
938589497 2:132722922-132722944 ACTCGGGAGAGGAAGGTGGGAGG - Intronic
938592950 2:132757092-132757114 AGGGGGAAGAGCAAGCTGAGAGG - Intronic
938682161 2:133703023-133703045 CTCTGGAGGAGGAAGGTGGGAGG + Intergenic
938730646 2:134144344-134144366 AGGAGGAAGAGAGAGGCGGGAGG + Intronic
940122034 2:150277815-150277837 AGGGGGAAGAGAGAGGTGGGAGG + Intergenic
940145640 2:150542434-150542456 AGGGGGATGGGGACGGTGGGGGG + Intergenic
940696378 2:156984673-156984695 AGGAGGAGGAGGAAGGAGGGAGG + Intergenic
940712624 2:157180568-157180590 GGTTGGAAGACGAAGCTGGGAGG + Intergenic
940852216 2:158699179-158699201 AGGGGGAGGAGGGAGGAGGGAGG + Intergenic
940963099 2:159807543-159807565 TGGTGGAAGAGGAAGGGTGCAGG + Intronic
941038211 2:160590557-160590579 AGGGGGAAGAGGAAGGGGGAGGG - Intergenic
941494136 2:166180491-166180513 AGGTGGAAGAGGGAGGAAGCTGG + Intergenic
941640178 2:167978756-167978778 ATCAGGAAGAGGAAGATGGGAGG - Intronic
942430659 2:175907602-175907624 TGGTTGAAGAGGAAGGGGGTTGG + Intergenic
942483141 2:176411081-176411103 AGGTGGAAGACAAAGGGGAGGGG + Intergenic
942537127 2:176976774-176976796 AGATGGACTAGGAAGGTGGCAGG + Intergenic
942606165 2:177693342-177693364 TGGTTGATGAGGATGGTGGGTGG + Intronic
942740273 2:179168172-179168194 AGGAGGAAGAGGAAGTGGAGGGG - Intronic
943179158 2:184521310-184521332 AAATGGAAGAGGAAGGTGGATGG + Intergenic
943278274 2:185896892-185896914 AGGAAGAAGAGGAGGGAGGGAGG + Intergenic
943325771 2:186496320-186496342 AGGAGGATGAGGCAGGTGGATGG - Intronic
943366240 2:186970100-186970122 TGGAGGATCAGGAAGGTGGGGGG - Intergenic
943769916 2:191705223-191705245 GAGTGGGAGAGGAAGGTGGTGGG + Intergenic
943890252 2:193277265-193277287 AGGAGGAGGAGGAAGGGGAGGGG - Intergenic
944142051 2:196467369-196467391 GGGAGGGAGAGGAAGGAGGGAGG + Intronic
944143896 2:196485514-196485536 AGGTGGAGGTGGAAGGCAGGGGG + Intronic
944644981 2:201770678-201770700 AAGTGGAAGAGGGAGGCAGGAGG + Intronic
944769785 2:202902517-202902539 AGGAGGCAGAGGAATGTGGAAGG + Intronic
944970137 2:204983406-204983428 AGTCGGGAGAGGAAGGGGGGAGG + Intronic
945032746 2:205680882-205680904 GGGAGGAAGAGGAAGGAGGGAGG + Intergenic
945042780 2:205755885-205755907 AGGGTGAAGAGAAAGGTGGATGG + Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945235635 2:207629010-207629032 AGGCTGAAGAAGGAGGTGGGGGG - Intergenic
946025264 2:216668227-216668249 GGGAGGATGAGGTAGGTGGGAGG - Intergenic
946148811 2:217750330-217750352 AGGAGGAAGAAGAGGGGGGGAGG + Intronic
946189931 2:218002768-218002790 AGGTGGCAGGGGCCGGTGGGGGG + Intronic
946200783 2:218069660-218069682 AGGTAAATGAGGGAGGTGGGTGG - Intronic
946236984 2:218330207-218330229 AGGGGGAGTAGGAAGGAGGGTGG - Intronic
946249436 2:218403560-218403582 AGGTGGATGAGGGGAGTGGGCGG - Intronic
946455429 2:219821681-219821703 AGATCAAAGAGGAAGGTGTGTGG - Intergenic
946474734 2:219996318-219996340 AGGTGAAAAATGAAGGTGGTTGG - Intergenic
947038185 2:225884258-225884280 AGGAGGAAGAGGAAGAGGAGGGG - Intergenic
947098866 2:226596856-226596878 AGGAAGAAGAGGAAGAAGGGAGG - Intergenic
947232674 2:227903647-227903669 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232682 2:227903664-227903686 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232690 2:227903681-227903703 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947536353 2:230942493-230942515 AGGTGGAAGAGGCAGGTGTGGGG + Intronic
947540455 2:230973935-230973957 AGGTGGAAGGGGACAGTGGGAGG - Intergenic
947868653 2:233419667-233419689 AGGTGGAAGAGGCTTGTGTGTGG + Intronic
947982606 2:234423344-234423366 AGGCAGAAGAGACAGGTGGGCGG + Intergenic
947985856 2:234446867-234446889 CGGTGGAAGGAGGAGGTGGGAGG - Intergenic
948069970 2:235112914-235112936 AGATGGAAGAGGAAGAGGAGGGG - Intergenic
948078683 2:235187832-235187854 AAGAGGAAGAGGAAGAGGGGAGG - Intergenic
948091863 2:235301981-235302003 AGGATGAAGAGGGAGGAGGGAGG - Intergenic
948091951 2:235302225-235302247 AGGAGGAAGAGGGAGGAGGAGGG - Intergenic
948316553 2:237031808-237031830 TGGGGAAAGAGGAAGGAGGGAGG + Intergenic
948319436 2:237057887-237057909 AGGAGGAAGAGAGAGGGGGGAGG - Intergenic
948428301 2:237902262-237902284 AGGTGGAAGAGGGAGGGGTAAGG + Intronic
948458834 2:238119494-238119516 AGGTGGATGGAGGAGGTGGGTGG + Intronic
948577695 2:238965135-238965157 AGAGGGAAGAGGGAGGAGGGAGG - Intergenic
948577738 2:238965285-238965307 AGAGGGAAGAGGGAGGAGGGAGG - Intergenic
948577780 2:238965421-238965443 GGATGGAGGAGGAAGGAGGGAGG - Intergenic
948644214 2:239393605-239393627 AGGAGGAAGGGGAGGCTGGGTGG - Intronic
948765656 2:240217470-240217492 CGGTGGAGGTGGACGGTGGGTGG - Intergenic
948790070 2:240372442-240372464 AGGTGGGAGAGGGATGTGGGAGG + Intergenic
948809174 2:240466222-240466244 AGGGGCAGGAGGAAGGTCGGGGG - Exonic
948924823 2:241088713-241088735 GGGAGGAAGAGGCAGGGGGGTGG + Exonic
1168769635 20:407389-407411 AGGTGGAAATGGACGGTAGGGGG + Intergenic
1168912250 20:1458199-1458221 AGGAGGAAGAGGAAGGCCAGAGG - Exonic
1169029894 20:2398826-2398848 ATGTGGTAGAGGGAGGTGGTGGG - Intronic
1169241610 20:3986229-3986251 AGGAGGAAAAGGAAGGAAGGAGG - Intronic
1169268765 20:4183337-4183359 GGATAGAAGAGGAAGGAGGGAGG - Intronic
1169422417 20:5471134-5471156 AGCTGGAAGACCCAGGTGGGCGG + Intergenic
1169851231 20:10053719-10053741 TGGTGGAGGCGGCAGGTGGGAGG - Intronic
1169930803 20:10830975-10830997 GGTTGGAAGACAAAGGTGGGAGG + Intergenic
1170055763 20:12200908-12200930 AGCTGGAGAAGGAGGGTGGGTGG + Intergenic
1170624629 20:18021805-18021827 AGGGGAAAGAGGAAGCAGGGAGG + Intronic
1170681635 20:18531199-18531221 AGATAGAAGAGGAAGTAGGGTGG + Intronic
1170757926 20:19221209-19221231 AGATGGAAGAGCCAGGTGTGAGG - Intronic
1170779631 20:19412618-19412640 AGGAGGAGGAGGAGGGGGGGAGG + Intronic
1170836938 20:19892671-19892693 AGAAGGAAGAGGAAGGAGGCTGG - Intronic
1171135886 20:22694100-22694122 AGGTGGATGAGGTAAGTGTGGGG - Intergenic
1171442725 20:25178276-25178298 AGGAGGAAAAGGAATGTGTGTGG + Intergenic
1171958284 20:31475859-31475881 AGGAGGAAGAGGCAGGAGGGCGG - Intronic
1172037074 20:32018381-32018403 AGGTTGAGGATGAAGGTGGGTGG + Intronic
1172113990 20:32563073-32563095 AGGGTGAAGGGGAAGGAGGGTGG + Intronic
1172646709 20:36474774-36474796 AGGTGGGGTAGGAAGGAGGGAGG - Intronic
1172834928 20:37867265-37867287 AGGAGGAAGAGGGAGGAGAGAGG - Intronic
1172877925 20:38177319-38177341 AGGTGGGAGAGGACGGAGGCTGG + Intergenic
1172879131 20:38187034-38187056 GGGTGGAGGAGGGAGGGGGGAGG + Intergenic
1172910636 20:38406940-38406962 ACGTGGGAGACTAAGGTGGGAGG - Intergenic
1173080010 20:39856973-39856995 AAGAGGAAGAGGAAGATGGGAGG - Intergenic
1173127902 20:40357146-40357168 AAGTGGGAGAGGAAAGTGAGAGG - Intergenic
1173302747 20:41818286-41818308 AGGTGGAAGAGGAAGCCATGGGG - Intergenic
1173344280 20:42184492-42184514 AGGAGGAGGAGGAAGGGGGGAGG - Intronic
1173564243 20:44027854-44027876 AGGTGGAGGATGTAGGAGGGAGG + Intronic
1173571394 20:44078976-44078998 AGGAGTAAGAGGAAGCTGGAAGG - Intergenic
1173676537 20:44840647-44840669 AAATGGAAGAGGGAGGTAGGAGG - Intergenic
1173698403 20:45043844-45043866 AGGGGAAAGTGGAAGGAGGGAGG - Intronic
1173759868 20:45550053-45550075 TGCTGGAAGAGCAAGGTAGGTGG + Intergenic
1173790430 20:45824487-45824509 AGGTGGATGAGGACGGTGAGCGG - Exonic
1173904011 20:46612893-46612915 AGGTGGGAGTTGAAGGTGGGGGG - Intronic
1174378772 20:50143158-50143180 AGGCGGGAGAGGATGGTGGCTGG + Intronic
1174379788 20:50149260-50149282 AGGGGGAAGGGAAAGGTGGAGGG - Intronic
1174633934 20:51982645-51982667 AGATGGTAGAAGAAGATGGGAGG + Intergenic
1174704140 20:52638613-52638635 AGGAGGAAGAGGAAGGCAAGTGG + Intergenic
1174873384 20:54204172-54204194 AGGTGGAGGAACAAGGTGTGAGG - Intergenic
1175010968 20:55735625-55735647 AGGAGAAAGAGGAAGGATGGAGG - Intergenic
1175120112 20:56710676-56710698 AGTGGGAAGAGGAAGAGGGGAGG - Intergenic
1175231195 20:57474415-57474437 ATGTGGAAAAGGGAGGTAGGAGG + Intergenic
1175234593 20:57501378-57501400 AGTTGGCTGAGGAGGGTGGGTGG + Intronic
1175237672 20:57525484-57525506 AAGTGGATGAGGAAGGGAGGAGG + Intronic
1175256624 20:57651963-57651985 AGGAGTGAGAGGAAGGCGGGGGG - Exonic
1175289800 20:57868153-57868175 AGGGGGGTGAGGAAGGTGAGAGG - Intergenic
1175298832 20:57928583-57928605 AGGAGGAGGAGAAGGGTGGGGGG - Intergenic
1175311337 20:58013681-58013703 AGCTGAAGGAGGAAGGTGGAGGG + Intergenic
1175335482 20:58193239-58193261 AGGTAGCAGAGCAAGGAGGGTGG + Intergenic
1175602643 20:60287479-60287501 AAGTGGAGGTGGAAGGAGGGAGG + Intergenic
1175669161 20:60886996-60887018 AGGTGGAAGTGGGTGGTGGGTGG - Intergenic
1175670944 20:60902518-60902540 AGGTGGAACAGTCAGGAGGGAGG + Intergenic
1175711146 20:61222056-61222078 ATGGGGAAGAGGAAGGCAGGAGG + Intergenic
1175781918 20:61688306-61688328 GGAGGGAGGAGGAAGGTGGGAGG - Intronic
1175802469 20:61808778-61808800 AGGTGGAGGGGGCAGGCGGGCGG - Intronic
1175834487 20:61984914-61984936 AGGAGGGCGAGCAAGGTGGGAGG + Intronic
1175841904 20:62033288-62033310 AGGCAGAAGAGGGAGGTGGCAGG + Intronic
1175853018 20:62103977-62103999 GGGAGGAACAGGGAGGTGGGCGG + Intergenic
1176057096 20:63154708-63154730 GGGAGGAAGAGGGAGGAGGGAGG - Intergenic
1176057113 20:63154760-63154782 GGGAGGAAGAGGGAGGAGGGAGG - Intergenic
1176100514 20:63362344-63362366 AGGAGGAGAAGGAAGGTAGGGGG - Intronic
1176362067 21:6006184-6006206 AGGAGGAGGAGGAGGGGGGGGGG + Intergenic
1176383986 21:6127878-6127900 AGGAGAAAGAGGAGGGAGGGAGG + Intergenic
1176425102 21:6543826-6543848 AGGTGGAAGAGCAAAGAGAGGGG - Intergenic
1176664234 21:9669595-9669617 AGGTGGAGGAGGAAGGGGCTGGG - Intergenic
1177169437 21:17639620-17639642 AGGAGGAAGAGAGAAGTGGGAGG + Intergenic
1177179925 21:17734126-17734148 AGGAGGAAGAGAGAGGAGGGAGG + Intergenic
1177249383 21:18572288-18572310 TGGTGGAAGGGGAAGGGGAGGGG + Intergenic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1177754767 21:25333085-25333107 AGGTGGAAGTGGGAGGTAGCAGG - Intergenic
1177758302 21:25373680-25373702 AGGAGGAGGAGGAAGGGAGGGGG - Intergenic
1178287750 21:31339351-31339373 AGGAGGAAGAGGAGGCTGGTTGG - Exonic
1178397122 21:32252424-32252446 AGGAGGAGGAGGAAGGGGAGAGG + Intergenic
1178494229 21:33073161-33073183 AGGTGGGGGAAGGAGGTGGGAGG + Intergenic
1178532675 21:33388517-33388539 ACCTGGAAGACTAAGGTGGGAGG + Intergenic
1178815412 21:35924743-35924765 GGGTGGAAGAGAAAGGAAGGGGG + Intronic
1179218642 21:39387859-39387881 AGCTGGAAGGGGGAGGGGGGGGG + Intronic
1179560262 21:42211437-42211459 AGGAGGAAGGGAAAGGTGAGTGG - Intronic
1179607123 21:42523864-42523886 AGGTGGGAAAGAAAGGTTGGTGG - Intronic
1179649526 21:42798423-42798445 GGGTGGGAGGGGAGGGTGGGGGG + Intergenic
1179700593 21:43152143-43152165 AGGTGGAAGAGCAAAGAGAGGGG - Intergenic
1179739488 21:43410360-43410382 AGGAGAAAGAGGAGGGAGGGAGG - Intergenic
1179761451 21:43532361-43532383 AGGAGGAGGAGGAGGGGGGGGGG - Intronic
1180228875 21:46414478-46414500 AGGAGGAAGAGGAGAGTGGGCGG - Intronic
1180228882 21:46414517-46414539 AGGAGGAGGAGCAGGGTGGGTGG - Intronic
1180228903 21:46414589-46414611 AGGAGGAGGAGCAGGGTGGGCGG - Intronic
1180228921 21:46414658-46414680 AGGAGGAGGAGCAGGGTGGGTGG - Intronic
1180228961 21:46414814-46414836 AGGAGGAGGAGCAGGGTGGGCGG - Intronic
1180228977 21:46414880-46414902 AGGAGGAAGAGCAGGGTGGGTGG - Intronic
1180469394 22:15641758-15641780 AGGGGGAGGAGGAAAGAGGGTGG - Intergenic
1180668833 22:17536851-17536873 AGGTGGGAGATGAAGGTGGCAGG - Intronic
1181068221 22:20316499-20316521 AGCTGGAGGAGGCAGGCGGGAGG + Intronic
1181491411 22:23262821-23262843 AGGCGGAAGAGGAAGCAGGGCGG + Intronic
1181761550 22:25062211-25062233 AGGTGGAAGAGGAAAAGGAGGGG - Intronic
1181931337 22:26403943-26403965 AGGAGGAGGAGGAAGGAGGAAGG + Intergenic
1182012494 22:27012288-27012310 AGGATGAAGATGATGGTGGGTGG + Intergenic
1182030410 22:27155015-27155037 TGGTGGAGGAGGAAGTTGTGAGG - Intergenic
1182062881 22:27410496-27410518 AGATGGAAGAGAAAGGTGTGTGG + Intergenic
1182090416 22:27590938-27590960 AGAGGGAAGAGGAGGGAGGGAGG + Intergenic
1182243177 22:28933781-28933803 AGGGGGAGGAGGGAGGAGGGAGG - Intronic
1182251528 22:29004726-29004748 GGGTGGAGGAGGGAGGAGGGCGG + Intronic
1182277380 22:29199265-29199287 AGGAGGAAGAGGAAGAGGAGTGG + Intergenic
1182369660 22:29801973-29801995 AGGTGGGAGAGACAGGTGGGAGG - Exonic
1182520177 22:30880682-30880704 AGGCGGGAGAGCAAGGTGTGAGG - Intronic
1182776430 22:32834571-32834593 AGGTGGCAGGGGGAGGTGGCTGG + Intronic
1183100241 22:35579331-35579353 AGGCGGAAGAGCAAGTGGGGTGG - Intergenic
1183215148 22:36474534-36474556 ACCTGGAGGAGGAAGGAGGGAGG + Intronic
1183637024 22:39070364-39070386 AGGAGGAGGAGGAAGGCAGGGGG - Intronic
1184002045 22:41682233-41682255 AGGAGGAAAAGGCAGGTGCGCGG - Intronic
1184453829 22:44598088-44598110 AGGTGGAGATGGAATGTGGGAGG - Intergenic
1184509344 22:44924041-44924063 AGGAGGAAGAAGAGGGAGGGAGG + Intronic
1184600240 22:45539127-45539149 AGGGGGAGGAGGGAAGTGGGAGG - Intronic
1184618473 22:45654692-45654714 ACATGGAAGACCAAGGTGGGTGG - Intergenic
1184729814 22:46366055-46366077 AGGTGGAGGGGGAAGGTGGAGGG + Intronic
1184764399 22:46564057-46564079 AGGAGGGAGATGAAGGAGGGCGG + Intergenic
1185089395 22:48757297-48757319 AGGAGGAAGAGGAAAGAGGAGGG + Intronic
1185181378 22:49365455-49365477 AGGAGCAGGAGGATGGTGGGAGG - Intergenic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
1185408437 22:50670918-50670940 ACCTGGGAGAGGAAGGTGGAGGG + Intergenic
1203281718 22_KI270734v1_random:135161-135183 AGCTGGAGGAGGCAGGCGGGAGG - Intergenic
949150187 3:757505-757527 TGGTGGATCAGGTAGGTGGGTGG + Intergenic
949157438 3:846793-846815 AGGAGGAAGAGACAGATGGGAGG - Intergenic
949546457 3:5077014-5077036 TGGTGCAAGATGAATGTGGGAGG - Intergenic
949549902 3:5104151-5104173 AGGAGGAAGAGGACTGGGGGAGG - Intergenic
950130052 3:10536459-10536481 AGGAGGAGGAGGAAGGAGGAAGG - Intronic
950265549 3:11570312-11570334 AGTTGGGGCAGGAAGGTGGGTGG - Intronic
950514383 3:13454648-13454670 AGGAGGAAGGGGAGGTTGGGGGG + Intergenic
950529616 3:13545672-13545694 AGCTGGAAGAGGAAGGCTAGAGG + Intergenic
950709661 3:14805255-14805277 GGATGGAAGAGGAAGGCAGGTGG - Intergenic
950863568 3:16171466-16171488 AGAAGGCAGAGGAGGGTGGGAGG + Intergenic
950991024 3:17437674-17437696 AGGGGGCAGAGGAAGGAAGGGGG + Intronic
951099366 3:18668848-18668870 AAGTGGAAGAGGAAGGCAGAAGG - Intergenic
951194140 3:19804711-19804733 AGGGGGAAGGGGGAGGAGGGAGG + Intergenic
951217821 3:20040840-20040862 AGGTGGAAGCGGGAGGGGGAGGG - Intronic
951510513 3:23495992-23496014 AGGTGGAATGGGGAGATGGGAGG - Intronic
951771157 3:26259100-26259122 ATGTGGAAGCGGGTGGTGGGGGG - Intergenic
952845382 3:37683780-37683802 AGGGGGTAGTTGAAGGTGGGGGG - Intronic
952966922 3:38626812-38626834 ATCTGGTAGAGGAACGTGGGAGG + Intronic
953020419 3:39109533-39109555 AGGGGGAAGAGGTAGGTGTGAGG + Intronic
953230263 3:41058369-41058391 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
953230269 3:41058386-41058408 GGGAGGAAGAGGGAGGAGGGAGG + Intergenic
953323952 3:41996758-41996780 AGGAGGATTAGGCAGGTGGGAGG - Intergenic
953703706 3:45215624-45215646 AGCTGTAAGAGGAATGTGGATGG - Intergenic
953806544 3:46074720-46074742 AGGAGGAAGAGGAAGAGGAGGGG + Intergenic
953807026 3:46079488-46079510 AGCTGGAAGTGGAAGGGAGGAGG - Intergenic
953891552 3:46755296-46755318 AGGTGGGTGAGGGAGGAGGGTGG - Intronic
954264490 3:49461846-49461868 AGGAGGAGAAGGAGGGTGGGAGG - Intergenic
954268402 3:49488238-49488260 AGATGGAAGAGGAAGGAGGTGGG - Intronic
954370358 3:50166851-50166873 AGGTGGTGGAGGAAGGAGTGAGG + Intronic
954579565 3:51695933-51695955 ATGTGGAAGACCCAGGTGGGAGG + Intronic
954645856 3:52131132-52131154 ATTTGGGAGAGGATGGTGGGCGG - Intronic
954939546 3:54358908-54358930 AGGAAGTAAAGGAAGGTGGGAGG - Intronic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955219432 3:57011556-57011578 GGGTGGCGGGGGAAGGTGGGGGG - Intronic
955283464 3:57616361-57616383 AGGAGGAGGAGGCAGGGGGGAGG + Intergenic
955478588 3:59365789-59365811 AGGTGGAAAAGCCATGTGGGTGG + Intergenic
955663335 3:61324606-61324628 TGGTGGAAGAGTGAGGTGGTAGG + Intergenic
955705371 3:61722189-61722211 AGGTGGAAGAGCAAAGAGAGAGG + Intronic
955833643 3:63030427-63030449 AGGAGGAAGAGGAAGGGGAGGGG + Intergenic
955941489 3:64150532-64150554 AGGAGGAGGAAGAAGGAGGGTGG - Intronic
956423425 3:69108898-69108920 GGGCTGAAGAGGAAGGTGGAAGG - Exonic
957212087 3:77272400-77272422 AGGAGGAAGAGAAGGGCGGGGGG + Intronic
958436128 3:94098093-94098115 AGGGGGAAGAGGCAGGTTGGTGG - Intronic
958536030 3:95404751-95404773 GGGTGGAAGGGGAGGGTTGGAGG + Intergenic
958662988 3:97095491-97095513 ATTTTGAAAAGGAAGGTGGGGGG - Intronic
959034667 3:101346968-101346990 AGGAGGAGGAGGAAGGAGGGAGG + Intronic
959539742 3:107524810-107524832 GGGGCGAAGGGGAAGGTGGGTGG + Intronic
959967869 3:112376638-112376660 AGCAGGCAGAAGAAGGTGGGAGG - Intergenic
960335611 3:116414006-116414028 AGGTGGAAAAGGAAGGAGGCAGG + Intronic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
960520385 3:118647667-118647689 AGGTAGAAGAGGAAGAAAGGGGG + Intergenic
960865456 3:122194941-122194963 AGGAGGAAGAGGAAGGGAGGTGG - Intronic
960884116 3:122376817-122376839 AGGGTAAGGAGGAAGGTGGGGGG + Intronic
960953185 3:123012752-123012774 AGGAGGAAGAGGAGGGGGGAAGG - Intronic
961028643 3:123583811-123583833 GGGTAGAAGGGAAAGGTGGGAGG + Intronic
961071772 3:123936686-123936708 AGGAGGGAGGGGAAGGTGGTAGG + Intronic
961282511 3:125775020-125775042 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
961345536 3:126260950-126260972 AGAAGGAAGAGGAGGGAGGGAGG - Intergenic
961450670 3:127000969-127000991 GGGTGGAGGTGGCAGGTGGGTGG + Intronic
961524440 3:127487647-127487669 AGGTGTGAGGGGAGGGTGGGGGG - Intergenic
961563698 3:127748367-127748389 AGGTGGGAGAGGGAGGAGGGAGG + Intronic
961569202 3:127786058-127786080 ATGTGGAGGAGGAAGGTGAGAGG + Intronic
961772103 3:129257606-129257628 AGCTGGAAGAGGAGGATGGCAGG + Exonic
961869382 3:129976783-129976805 AAGAGGAAGAGGAAGAAGGGGGG + Exonic
962076810 3:132090746-132090768 AGGAGGAAGAGAGAGGAGGGAGG + Intronic
962077368 3:132096844-132096866 AGGTGGAGGTGGAGGGAGGGTGG + Intronic
962500233 3:135984096-135984118 AGTTAGAAGGGGAAGGAGGGAGG - Intronic
962763765 3:138542592-138542614 AGGTGCCAGTGGAGGGTGGGAGG + Intronic
962785122 3:138761383-138761405 AGGAGGAAGAAGATGGTGGAAGG + Intronic
962842822 3:139251371-139251393 AGGAGGAGGAAGAAGGAGGGAGG - Intronic
963106789 3:141654177-141654199 GAGGGGAAGAGGAAAGTGGGGGG + Intergenic
963470772 3:145739087-145739109 AGGAGGCAGAGTGAGGTGGGTGG - Intergenic
963652939 3:148006982-148007004 AGGAGGAAGAGGAAGGGGAAGGG - Intergenic
963709291 3:148728008-148728030 ATGTGGGAGAGGGAGGTGTGGGG - Intronic
964373649 3:156028339-156028361 AGGTGGAAGACGAGGGGTGGGGG + Intergenic
964421096 3:156503664-156503686 AGGTGAAAGATAAAGGTGGAGGG + Intronic
964452673 3:156826632-156826654 AGGAGGAGGAGGAGGGTGCGGGG - Exonic
964453944 3:156839993-156840015 AGGAGGAAGAGGAAGAGGAGGGG - Intronic
964544031 3:157812901-157812923 AGGGGGAAGAGGAGGAAGGGAGG + Intergenic
964672165 3:159238634-159238656 AGGTTGCTGAGGAAGGAGGGTGG + Intronic
965216982 3:165875367-165875389 GGGTGGAGGAGGTAGCTGGGAGG - Intergenic
965333597 3:167407739-167407761 AGGAGGAAGAGGAAGAGGAGGGG + Intergenic
965768749 3:172158863-172158885 AGGAGGGAGAGGAAGAGGGGAGG - Intronic
965798007 3:172461577-172461599 ATTTTGAAGAGGAAGGTAGGGGG - Intergenic
965904229 3:173683275-173683297 AAGAGGAAGAGGAAGGAAGGAGG - Intronic
966002544 3:174968131-174968153 AGGTGGGAAATGAAGTTGGGAGG - Intronic
966319462 3:178685020-178685042 GAGTAGAAGAGGAAGGAGGGAGG - Intronic
966332129 3:178826168-178826190 GGGTGGAAAAGGGAGGAGGGTGG - Intronic
966906553 3:184530368-184530390 AGGGGGAGGAGGAAGATGGAGGG + Intronic
966906557 3:184530374-184530396 AGGAGGAAGATGGAGGGGGGAGG + Intronic
966906565 3:184530394-184530416 AGGAGGAAGATGGAGGGGGGAGG + Intronic
966908588 3:184544790-184544812 AGGAGGAGGAGGAAGGGGAGAGG - Intronic
966908604 3:184544842-184544864 AGGAGGAGGAGGAAGGGGAGAGG - Intronic
966941912 3:184753191-184753213 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966941916 3:184753207-184753229 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966941920 3:184753223-184753245 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966941932 3:184753265-184753287 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942034 3:184753680-184753702 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942038 3:184753696-184753718 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942042 3:184753712-184753734 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942169 3:184754203-184754225 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942190 3:184754287-184754309 TGGTGGAAGAAGAAGGTGGTGGG + Intergenic
966942224 3:184754419-184754441 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942257 3:184754545-184754567 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942264 3:184754577-184754599 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942278 3:184754638-184754660 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942296 3:184754712-184754734 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942303 3:184754744-184754766 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942307 3:184754760-184754782 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942311 3:184754776-184754798 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942319 3:184754805-184754827 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
966942333 3:184754866-184754888 TGGTGGGAGAAGAAGGTGGTGGG + Intergenic
967304155 3:188044502-188044524 AGGTGAAAGCTGAAGGTGGGGGG + Intergenic
967351635 3:188520280-188520302 AGGTGGGAGGGGAAGATGCGAGG - Intronic
967443788 3:189540734-189540756 AGGTGCAGGAGCAAGGTGAGGGG - Intergenic
967810148 3:193752785-193752807 ACTTGGAAGACTAAGGTGGGAGG - Intergenic
967972203 3:195007312-195007334 ACGTGGAAGACTGAGGTGGGAGG + Intergenic
967978856 3:195053111-195053133 AGGTGGGAGCGGGAGGTGGGAGG - Intergenic
968339213 3:197941151-197941173 AGGAGAGAGAGGAAGGAGGGAGG - Intronic
968814973 4:2817570-2817592 AGGTGGAAGATGGAGGAGGCAGG + Intronic
968822447 4:2865017-2865039 AGGAGGAACAGGGAGCTGGGTGG - Intronic
968889369 4:3359373-3359395 AGGGGGAGGAGGAAGGGGAGGGG - Intronic
969015216 4:4099377-4099399 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
969262255 4:6041435-6041457 AGGAGAAGGAGGAAGGTGGAAGG - Intronic
969454813 4:7294951-7294973 AGGAGGAAGAGGAGGGGAGGGGG - Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969738718 4:9008874-9008896 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969797922 4:9540519-9540541 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969870840 4:10103783-10103805 AGTGGGAGGAGGGAGGTGGGGGG - Intronic
970011961 4:11469070-11469092 AGGTGCATGAGGAAGGAGTGGGG + Intergenic
970088482 4:12374884-12374906 AGGAGGCAGAAGAAGGTGGGAGG - Intergenic
970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG + Intergenic
970512874 4:16798599-16798621 TGAGGGAAGAGGGAGGTGGGGGG - Intronic
971059643 4:22953276-22953298 AGGTGGAACAGCAAGATGGAAGG + Intergenic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
971481346 4:27117517-27117539 AAGGAGAATAGGAAGGTGGGTGG - Intergenic
971720514 4:30239563-30239585 AGGTGGATCATGAAGGAGGGTGG - Intergenic
971767732 4:30854788-30854810 AAGTGGAAGAGGAGGGTTGTGGG + Intronic
972103139 4:35447468-35447490 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972103215 4:35447771-35447793 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972103228 4:35447818-35447840 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972241955 4:37203294-37203316 GGGTGGAAGATAAATGTGGGTGG - Intergenic
972564199 4:40255487-40255509 AGGAGGAAGAGAAAGGGGAGAGG - Intergenic
973268894 4:48240330-48240352 AGCAGGAAGAGAAAGGAGGGAGG + Intronic
973616391 4:52682640-52682662 AGGAGGCAGAGGAAAGTGGAAGG - Intergenic
973778424 4:54265464-54265486 AGGCAGAAGAGGAAGGGGTGCGG - Intronic
973885613 4:55318027-55318049 AGGAGGAAGAGGAAGGAGAAGGG + Intergenic
974496802 4:62640371-62640393 GGGTGCAACAGGGAGGTGGGAGG - Intergenic
974790491 4:66682190-66682212 ACATGGGAGAGCAAGGTGGGAGG - Intergenic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
975362351 4:73485676-73485698 AGGTGGAAGAGAAGGAGGGGGGG + Intronic
975631781 4:76411291-76411313 ACGTGGAAGGGTGAGGTGGGAGG + Intronic
976161961 4:82211136-82211158 GGGTGGAAGGGGAAGGTGCTGGG + Intergenic
976478381 4:85510792-85510814 AGGAGGAGGAGGAAGGGGAGGGG - Intronic
976582256 4:86751000-86751022 AGAGGGAAAAGGAAGGTAGGAGG - Intronic
976883780 4:89962008-89962030 AGGAGGAAGAGGAAGGAAAGTGG + Intergenic
977257166 4:94754199-94754221 GGGTGGAAAAGGAAAGTGGTAGG + Intergenic
977836347 4:101649665-101649687 TGTGGGAAGAGAAAGGTGGGTGG + Intronic
977919220 4:102625191-102625213 GGGAGAAAGAGGAAGGAGGGAGG - Intergenic
978094008 4:104752829-104752851 AGGAGGAAAAGGAAAGTGAGCGG + Intergenic
978389643 4:108212003-108212025 AGGCTGAAGACCAAGGTGGGAGG - Intergenic
978935606 4:114371409-114371431 AGGAGGAGGAGGAAGGAGAGGGG - Intergenic
979253668 4:118590411-118590433 AGGAGCAAGAGGATGGGGGGAGG - Intergenic
979282669 4:118885177-118885199 AGGTGGAAGAAGTAGGTAGTGGG + Intronic
980129155 4:128802829-128802851 AGGCGGGAGAGGAAGCAGGGAGG - Intergenic
980655486 4:135778384-135778406 AAGTGGAAGTTGGAGGTGGGAGG - Intergenic
980884996 4:138752637-138752659 GGGTGGAGGAGGAAGGAAGGGGG - Intergenic
981081529 4:140643218-140643240 AGGAGGAGCAAGAAGGTGGGAGG - Intronic
981443201 4:144806601-144806623 TGGTGGTAGTGGCAGGTGGGTGG - Intergenic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
981747250 4:148063702-148063724 AGGTGGAAGAGGCTGCTGGAGGG - Intronic
981779305 4:148408044-148408066 AGCCGGAGGAGGCAGGTGGGAGG - Intronic
981814005 4:148807656-148807678 AAGGGGAAGGGGAAGGAGGGTGG + Intergenic
981911656 4:149988572-149988594 AGGAGGAGGAAGAAAGTGGGAGG - Intergenic
981998581 4:151001543-151001565 TGGTGGTAGCGGCAGGTGGGGGG - Intronic
982070194 4:151687738-151687760 GGGTGAAACAGGAAGGGGGGAGG - Intronic
982105770 4:152010846-152010868 AGGAGGAAGATGTTGGTGGGAGG - Intergenic
982335377 4:154231280-154231302 AAGTGAAAGAGGAAGGGAGGGGG - Intergenic
982346188 4:154362735-154362757 AGGAGGAAGAGGAAGGAGAAGGG - Intronic
983640391 4:169939777-169939799 AGGAGGAAGAGGAAGAGGAGGGG + Intergenic
983913834 4:173269345-173269367 AGGTGGAAGATAAAGTGGGGAGG - Intronic
984602386 4:181743620-181743642 AGGTGGAATAGGCAGGAGTGTGG + Intergenic
984620326 4:181944863-181944885 AAGTGGAAGAGGAAGGAGGGAGG - Intergenic
984888490 4:184472666-184472688 AGGTTGAAGAGGGAGGGGGCGGG + Intronic
985208326 4:187565310-187565332 AGGGGGAAGAGGAAGGGAGGAGG - Intergenic
985511848 5:317941-317963 AGGTGGAGGGTGAAGGGGGGAGG - Intronic
985634385 5:1028706-1028728 AGCTGGGACAGGAAGGGGGGCGG + Intronic
985667770 5:1191131-1191153 AGGTGGAAGAGGAAGCTCCAGGG + Intergenic
985851626 5:2392626-2392648 AAGAGAAAGAGGAAGGAGGGAGG - Intergenic
985870642 5:2552687-2552709 AGGCTGAGGAGGAAGGAGGGAGG - Intergenic
985937180 5:3106349-3106371 GGATGGAAGGGGAAGGTGAGGGG + Intergenic
986038244 5:3961359-3961381 GGGTGGAAAATGCAGGTGGGGGG - Intergenic
986263675 5:6173805-6173827 AGGGGGAGGAGGGAGGGGGGAGG - Intergenic
986285609 5:6356170-6356192 AGGTGGAAGAGGAGAGTCAGGGG - Intergenic
986522322 5:8633019-8633041 AGGAGGAGGATGAAGGGGGGTGG + Intergenic
986752122 5:10796664-10796686 GGATGGAAGAGGTAGGTGGAGGG - Intergenic
987032855 5:13991510-13991532 AGGAGGAAGAGGAGGGGAGGAGG + Intergenic
987062622 5:14257107-14257129 AGGTGGAAGCCGAAGATGGGAGG + Intronic
987518244 5:18943937-18943959 AGGTGGTAGAGTGAGGTGTGGGG + Intergenic
987985797 5:25144183-25144205 AGGAGGAGGAGGAAGAGGGGAGG + Intergenic
988194456 5:27984870-27984892 TGTTGGAAGAGGAAGGTGATTGG - Intergenic
988393745 5:30669757-30669779 AGCAGGAAGAGGAAGTTGGAAGG + Intergenic
989056589 5:37371358-37371380 AGGGTGAGGAGGAAGGAGGGAGG + Intergenic
989141921 5:38209966-38209988 AGGGGGAAATGGAAGGTGGGAGG - Intergenic
989170590 5:38467890-38467912 AGCTGGAAGAGGCAGGGAGGAGG - Intergenic
989556822 5:42806616-42806638 AGGTGGAAGAGGAGGAAGTGTGG + Intronic
989677404 5:43987611-43987633 AGGTGAAATAGCAAGGTTGGAGG + Intergenic
989691585 5:44151706-44151728 AGATGGAAGAGGAAGATAAGCGG + Intergenic
990056154 5:51581231-51581253 AGATGGAAGAGGAAAGTGGAGGG + Intergenic
990077444 5:51867083-51867105 AAGTAGAGTAGGAAGGTGGGGGG - Intergenic
990222562 5:53609018-53609040 AGGAGGAAGAGGAAAGAGAGGGG + Intronic
990580556 5:57163676-57163698 AGGTGAAAGATGATGGTGGCTGG - Intergenic
990589639 5:57249744-57249766 AGGGGGAGGGGGAAGGGGGGAGG - Intronic
990816841 5:59795348-59795370 AGAAGGAAAAGGAAAGTGGGAGG + Intronic
991082489 5:62616057-62616079 AGGTGGGGGAGGAAGGGGGGTGG + Intronic
991433595 5:66573397-66573419 AGGGAGGAGAGGAAGGAGGGAGG + Intergenic
991500727 5:67274168-67274190 AGGTGGAACAGCTTGGTGGGTGG + Intergenic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
991968448 5:72114736-72114758 AGGAGAAAGAGGACAGTGGGAGG + Intronic
992229047 5:74645304-74645326 AGGAGGAAGAGGCAGGAGGATGG - Intronic
992319713 5:75601565-75601587 AGCAGGCAGAGGAAGGTGGAAGG + Intergenic
992415299 5:76546880-76546902 AGGTGGGAGTGGAGAGTGGGAGG + Intronic
992612973 5:78523438-78523460 AGGGGGTAGAAGAAGGCGGGAGG + Intronic
993038280 5:82782830-82782852 AGGAGGAAGAGGAAGAGGAGTGG - Intergenic
993052308 5:82939858-82939880 AGGTAGAAGAGGGAGATGGAGGG - Intergenic
993116624 5:83726941-83726963 GGGTGGAAGATGAGGGTGAGGGG - Intergenic
993249628 5:85503113-85503135 AGATGTATGAGAAAGGTGGGGGG - Intergenic
993264348 5:85704750-85704772 AGATGTAAGAGGCAGGTAGGAGG - Intergenic
993803727 5:92377143-92377165 ACTTGGAAGGGTAAGGTGGGAGG + Intergenic
993901150 5:93584922-93584944 AAGGGGAAGGGGAAGGGGGGAGG - Exonic
994441644 5:99813497-99813519 AGGAGGAGGAGGAAGATGAGGGG - Intergenic
994730011 5:103480974-103480996 AGGCTAAAGAGGTAGGTGGGAGG - Intergenic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
994869699 5:105331666-105331688 AGGGGGAGGAGGAAGGAGGGAGG + Intergenic
994944044 5:106361926-106361948 AGATGGAAGAGAAAGGGAGGAGG - Intergenic
995400637 5:111737096-111737118 ATGTGGAAAAGTAAGGTGGTTGG - Intronic
995804782 5:116039041-116039063 GGGTGGGGGAAGAAGGTGGGTGG + Intronic
995908286 5:117153495-117153517 AGGAGGAAGAGGAAGAGAGGAGG - Intergenic
996911015 5:128656578-128656600 AGGAGGAAGAGCAAGGGGGGAGG + Intronic
997266188 5:132496646-132496668 GAGCGGAAGGGGAAGGTGGGGGG - Intergenic
997364749 5:133318793-133318815 AGGTCCAGGAGGAAGGTTGGGGG - Intronic
997437436 5:133885470-133885492 AGGAGGCAGAGAAAGGAGGGAGG + Intergenic
997834487 5:137181227-137181249 AGGCAGGAGAGGAAGGTGGAGGG + Intronic
998234165 5:140383504-140383526 AGGAGGAAGTGGAGGGTGGAGGG + Intergenic
998405473 5:141872122-141872144 AGGTGGAGGGGGGGGGTGGGGGG - Intronic
998611510 5:143694303-143694325 AGGAGGAGGAGGGAGGGGGGAGG - Intergenic
998611511 5:143694306-143694328 AGGAGGAGGAGGAGGGAGGGGGG - Intergenic
999079436 5:148828958-148828980 AAGTAGAACTGGAAGGTGGGTGG - Intergenic
999147607 5:149406515-149406537 AGGAGGAGGAGGAAGGGGGTGGG - Intergenic
1000045430 5:157518308-157518330 AGGTGGGGGAGGAAGGGGCGGGG + Intronic
1000252553 5:159509476-159509498 GGGTGGGAGAGGAAGGAGAGAGG + Intergenic
1000268189 5:159657979-159658001 GGCTGGGAGGGGAAGGTGGGTGG + Intergenic
1000304465 5:159983107-159983129 AGGTTGAAGGGGAAGGAAGGTGG - Intergenic
1000355963 5:160396135-160396157 GGGTGGAAGAGTGGGGTGGGAGG - Intronic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1001103676 5:168834725-168834747 AGATGGAGGTGGAAGGTGAGGGG + Intronic
1001190890 5:169630180-169630202 AGGGGGAATTGGGAGGTGGGGGG + Intergenic
1001215418 5:169851726-169851748 TGGTGGAAGGGGAAGCAGGGAGG + Intronic
1001241891 5:170077628-170077650 AGGTGGAGGAAGAAGGTGACAGG + Intronic
1001313794 5:170629049-170629071 AGGTGGGAGTGGAGGGCGGGAGG - Intronic
1001511078 5:172322405-172322427 AGGAGGAAAAGGAGGGAGGGAGG - Intergenic
1001850243 5:174957568-174957590 GGGGGGAAGAGGAAGGGGGCAGG - Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1001981157 5:176037755-176037777 AGATGGAGGGGGAAGGAGGGTGG + Intergenic
1002000501 5:176194108-176194130 AGCTGGAGGAGGAATGAGGGAGG + Intergenic
1002236302 5:177806311-177806333 AGATGGAGGGGGAAGGAGGGTGG - Intergenic
1002253835 5:177944873-177944895 AGCTGGAGGAGGAATGAGGGAGG - Intergenic
1002491954 5:179584653-179584675 AGGTGGGAGGCCAAGGTGGGAGG + Intronic
1002606354 5:180385188-180385210 AGGGGGAAGAAGACGGTGGAGGG + Intergenic
1002788666 6:423389-423411 AGCCAGAAGAGGAAGGTGAGTGG + Intergenic
1002896496 6:1383107-1383129 AGGTGGAGGCGGGAGTTGGGAGG + Intergenic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1003002802 6:2351685-2351707 GGGGGGAAGTGGGAGGTGGGTGG - Intergenic
1003122434 6:3329155-3329177 TGGGGGATGAGGGAGGTGGGGGG - Intronic
1003127630 6:3368217-3368239 ATGTGGAAGAGCAGGGTGTGAGG - Intronic
1003226693 6:4212383-4212405 AGCTGGAGGAGGAAGGTGCTAGG - Intergenic
1003282380 6:4705240-4705262 AGGAGGAGGAGGTGGGTGGGTGG - Intergenic
1003381807 6:5631135-5631157 AGCTGGGAAAGGAAGGTGTGAGG + Intronic
1003406753 6:5832552-5832574 AGGAGGAAGAGGAGGGGGGAGGG + Intergenic
1003491732 6:6628251-6628273 AGGAGGAAGGGGAGGGAGGGAGG - Intronic
1003761216 6:9180846-9180868 AGGGGCAGGAGCAAGGTGGGAGG + Intergenic
1003873153 6:10417224-10417246 GGGTGGCAGAGGATGGAGGGCGG - Intronic
1004065900 6:12243379-12243401 AGGTGGAGGAGGTGGGAGGGAGG + Intergenic
1004187418 6:13432791-13432813 AGGAGACAGAGCAAGGTGGGAGG - Intronic
1004373180 6:15070277-15070299 AGGAGGAAGAGAGAGGCGGGAGG - Intergenic
1004447040 6:15710105-15710127 AAGGGGAAGAGGAAGGGGAGGGG - Intergenic
1004720336 6:18263835-18263857 AGGAGGAGGAAAAAGGTGGGGGG - Exonic
1004777135 6:18860346-18860368 AGGAGCAAGAGAGAGGTGGGAGG + Intergenic
1005006602 6:21293424-21293446 AGTTGGGAGGGGAAGATGGGAGG - Intergenic
1005173456 6:23015061-23015083 AGGAGGAAGTGGAAGGTGGAAGG + Intergenic
1005520882 6:26599244-26599266 AGGTTAAACAGTAAGGTGGGTGG - Exonic
1005560834 6:27039278-27039300 TTGTGGAAGAGGAAGGTGCCAGG - Intergenic
1005826190 6:29632922-29632944 AGGTGGAGGAGAAGGGAGGGGGG - Exonic
1005989759 6:30895578-30895600 AGGAGGAAGTGCAAGGTGTGAGG - Intronic
1006088993 6:31616687-31616709 AGGGGGAAGAGGAAGGGCAGGGG - Intronic
1006149537 6:31979231-31979253 AGGGGGAGGAGGAGGGGGGGAGG + Intronic
1006731632 6:36240343-36240365 AGGAGGAAGAGAAGGGAGGGTGG - Intergenic
1006789097 6:36686906-36686928 GGGTGGATGAGGAAGGTCGCTGG - Exonic
1007134473 6:39507945-39507967 AGGAGGAAGGGGAAGGGGTGGGG - Intronic
1007412713 6:41674267-41674289 GGGTGGGAGAGTAGGGTGGGGGG - Intergenic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1007634498 6:43290357-43290379 AGGAGGAGGAGGAAGATGAGGGG + Intergenic
1008288369 6:49682473-49682495 AGGAGGAGGAGGAGGGAGGGAGG - Intergenic
1008354583 6:50537135-50537157 TGGGGGAAGAGGGAGGGGGGAGG - Intergenic
1008860110 6:56138831-56138853 ATGTGGTAGAGGAAGTGGGGAGG + Intronic
1009355622 6:62740482-62740504 GGGGGGAAGATGCAGGTGGGTGG - Intergenic
1009593661 6:65708576-65708598 AGGAGGAGGAGGAAGGGAGGGGG - Intergenic
1010044514 6:71425484-71425506 AGGTGGGAGAGGAAAGAAGGGGG + Intergenic
1010123931 6:72411349-72411371 TGATGGAAGAGGAAGGAGGCAGG + Intergenic
1010220386 6:73443594-73443616 ATGTGGGAGATGGAGGTGGGGGG - Intronic
1010232216 6:73545106-73545128 AGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1010632354 6:78213187-78213209 AGGTGGAGGAGGAGGAAGGGAGG - Intergenic
1010887410 6:81261857-81261879 AGGAAGAAGAGGAAGGGGAGGGG + Intergenic
1011437808 6:87357602-87357624 AGGTAGAAGAGGAAGATGAGAGG + Intronic
1012044235 6:94248991-94249013 AGGTGGGTGGGGAAGGTGGTTGG + Intergenic
1012323915 6:97889285-97889307 AGGGGGAAGAGGAAGGGAAGAGG + Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013001468 6:106027059-106027081 TTGTGGAAGAATAAGGTGGGTGG - Intergenic
1013007027 6:106083241-106083263 AGTAGGAAGAAGAGGGTGGGGGG + Intergenic
1013105753 6:107025498-107025520 AGAGGGAGGAGGAAGGTGGTGGG + Intergenic
1013267155 6:108511140-108511162 AGGAGGAGGAGGGAGGTAGGAGG + Intronic
1013399026 6:109773170-109773192 AGGCTGAAGAGGAAGGCAGGAGG - Intronic
1013461145 6:110376594-110376616 AGGGGGAGGTGGAATGTGGGAGG + Intergenic
1013887499 6:114987994-114988016 AGCAGGCAGAGGAAGGTGGAAGG + Intergenic
1014029253 6:116681782-116681804 AGGTGGAGGAGGGAGGCTGGCGG - Intronic
1014153779 6:118088641-118088663 AGGTGGCAGTAGAAGGTGTGAGG + Intronic
1014416402 6:121190242-121190264 AGGTGGAGGGGGAAGGAGGGAGG - Intronic
1014534753 6:122601595-122601617 AGGAGGAAGAGGAAGAGGAGGGG - Intronic
1014684364 6:124477702-124477724 AGGGGGAAGAGTAAGGGGGAGGG - Intronic
1015122305 6:129712873-129712895 AGGGGGGAGAAAAAGGTGGGAGG - Intergenic
1015255513 6:131175252-131175274 AGGTGGAGGTGGAAGTGGGGAGG + Intronic
1015383138 6:132592664-132592686 AGGAGGAAGAGGCAGAAGGGAGG - Intergenic
1015484090 6:133748662-133748684 AGGTGGAAGAGAAATGGGGTAGG - Intergenic
1015645214 6:135379941-135379963 AGGGAGAAGGGGAAGGAGGGAGG - Intronic
1016142874 6:140634544-140634566 AAGTGGAAGACTAAGGTGGAAGG - Intergenic
1016417763 6:143851013-143851035 AGGTGGAAGAAGGAGGGGGAGGG + Intronic
1016784302 6:147993251-147993273 AGGAGGAAGAGGAAGAAGAGGGG + Intergenic
1016794727 6:148105757-148105779 AGGAGAAGGAGGAAGATGGGGGG + Intergenic
1016911602 6:149204730-149204752 AGGATGGAGAGAAAGGTGGGAGG + Intergenic
1017004593 6:150020722-150020744 AGAAGGAAGAGGAGGGTGGGAGG + Intronic
1017005759 6:150027226-150027248 AGAAGGCAGAGGGAGGTGGGGGG + Intergenic
1017041239 6:150310118-150310140 AGGTGGGATAGGAAGGTGGTGGG - Intergenic
1017166025 6:151409170-151409192 AGGTGGGAAAGGAAGATGAGGGG + Intronic
1017357633 6:153528428-153528450 AGCTGGCAGAAGAAGGTGGAAGG - Intergenic
1017783430 6:157734445-157734467 AGGTGGAAAAGGCAGGGAGGAGG - Intronic
1018038046 6:159898545-159898567 AGGAGGAAGAGGCAGGAGGAGGG - Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018176811 6:161184418-161184440 ATGGGGGAGAGGAAGGTGTGTGG + Intronic
1018213701 6:161506634-161506656 AGGAGGATGATGCAGGTGGGTGG + Intronic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018377518 6:163227266-163227288 AGGAACAAGAGGGAGGTGGGAGG + Intronic
1018627164 6:165791213-165791235 CGTTGGAAGGGCAAGGTGGGAGG + Intronic
1018666264 6:166141206-166141228 TGGAGGAAGAGGCAGGTGGTGGG - Intergenic
1018670073 6:166169770-166169792 AGGTGAAGGAGGAACGAGGGTGG + Intergenic
1018683879 6:166286837-166286859 AGGTGGAAGGGGCCGCTGGGGGG + Intergenic
1019438579 7:1034766-1034788 AGGAGGAAAAGGAGGGTGGAGGG - Intronic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019494899 7:1333297-1333319 AGGAGGAAGAGGATGATGGGAGG - Intergenic
1019495456 7:1337603-1337625 AGGAGGGAGAGGAGGGAGGGAGG - Intergenic
1019535372 7:1526482-1526504 AGGAGGAAGAGGAAGAAGGAGGG + Intergenic
1019563714 7:1669871-1669893 AGGTGGAGGGGGTGGGTGGGTGG - Intergenic
1019693490 7:2431516-2431538 AGGTGGAAGGAGATGGTGTGAGG - Intronic
1019769428 7:2874318-2874340 AGGTGGATGAGAATGTTGGGTGG + Intergenic
1019779305 7:2930138-2930160 AGGTGGAAGAGAGAGAGGGGAGG + Intronic
1019862199 7:3669649-3669671 AGGAGGGAGAATAAGGTGGGAGG - Intronic
1019992029 7:4698795-4698817 ACTTGGAAGACTAAGGTGGGAGG - Intronic
1019994846 7:4717393-4717415 AGGTGGTAGCGGGAGGTGTGTGG + Intronic
1020410499 7:7886845-7886867 AGGCTGGAGAGGCAGGTGGGGGG - Intronic
1020577783 7:9956356-9956378 AAAAAGAAGAGGAAGGTGGGGGG - Intergenic
1021181488 7:17511083-17511105 AGGTGGAAGAGTAAAGTAGAGGG - Intergenic
1021225814 7:18025089-18025111 AGGTGGAGCAGGGGGGTGGGGGG - Intergenic
1021480650 7:21111937-21111959 AGATGGAAGAGAAAGGGGAGGGG - Intergenic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022102344 7:27175896-27175918 AGGTGGAAGAGGAGCCTGAGAGG + Intronic
1022474006 7:30698661-30698683 AGGTGGAGGAGAGAGGTGGGAGG - Intronic
1022523214 7:31020952-31020974 AGGTGGAACAGGATGGAGGGAGG + Intergenic
1022872588 7:34494742-34494764 AGTAGCAAGAGGAAGGTTGGGGG - Intergenic
1023025313 7:36044485-36044507 AGGTAGAAAAGGAATGTGTGGGG + Intergenic
1023067254 7:36390094-36390116 GGTTGACAGAGGAAGGTGGGTGG - Exonic
1023454195 7:40320923-40320945 AGGTGGAAGGGGAGTGAGGGAGG - Intronic
1023458506 7:40367912-40367934 AGGAGGAGGAGAATGGTGGGAGG - Intronic
1023807536 7:43884267-43884289 AGGTGGAAGAGGAAGCAGCAGGG + Intronic
1023837062 7:44074445-44074467 AGGTGGTGGAGGAAGCTGTGGGG - Exonic
1024028355 7:45433337-45433359 AGGAGGGAGAGGAAGGAGGAGGG - Intergenic
1024458235 7:49632782-49632804 AGGTGGGTGAGGGAGGTGGGTGG - Intergenic
1024596934 7:50946414-50946436 AGGAGCAAGAGAGAGGTGGGGGG + Intergenic
1024655130 7:51445950-51445972 AGGTGAAACAGTCAGGTGGGAGG + Intergenic
1024657380 7:51462948-51462970 AGGTGGAAGATGCTGGTGGCTGG - Intergenic
1025055375 7:55760725-55760747 AAGTGGAAGAGGGAGGTAGAAGG + Intergenic
1025623260 7:63193758-63193780 AGGTTGAAGCGGAAGAAGGGTGG - Intergenic
1025887761 7:65614467-65614489 AGGAGGAGGAGGAAGGATGGAGG - Intergenic
1026191898 7:68136468-68136490 AGGAGGAGGAAGAAGATGGGAGG + Intergenic
1026205744 7:68255688-68255710 AGGAGGAAGAGGTGGGTAGGAGG - Intergenic
1026304597 7:69129645-69129667 AGGAGGAAGAGAGAGGGGGGAGG + Intergenic
1026333460 7:69373317-69373339 AGGAGGAAGAGGAAGTGAGGAGG + Intergenic
1026594987 7:71726993-71727015 TGGGGGAAGAAGCAGGTGGGAGG - Intergenic
1026927560 7:74204521-74204543 AGGGGGGAAAGGAAGGAGGGAGG + Intronic
1027595662 7:80170647-80170669 AGGAGGAAGAGAGAGGCGGGAGG + Intronic
1027717598 7:81692672-81692694 AACTGGATCAGGAAGGTGGGTGG + Intergenic
1027806346 7:82829299-82829321 AGGGGCAAGAGGGAAGTGGGTGG - Intronic
1028338929 7:89694313-89694335 ATGTGGAGGAGGCAGGTAGGGGG - Intergenic
1028792286 7:94866684-94866706 AGGAGGAAGAGAGAGGGGGGAGG - Intergenic
1028959481 7:96732735-96732757 AGGAGGAAAAGAAAGGTAGGGGG - Intergenic
1029073892 7:97921038-97921060 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1029425377 7:100490960-100490982 AGGTGGAAGAAGGAGGAGTGAGG - Intronic
1029538459 7:101169399-101169421 AGGTGGAAGTTGAAGGAGGCTGG - Intergenic
1029653967 7:101912234-101912256 AGGAGGAGGAGGGAGGGGGGAGG - Intronic
1029805447 7:102991300-102991322 TGGGGGAAAAGGAAGGTTGGAGG + Intronic
1029843829 7:103393025-103393047 AGGTGGAAGAGGCTGGTGTCCGG + Exonic
1030034450 7:105396696-105396718 AGGAGGAGGAGGAAGGGGAGGGG + Intronic
1030281507 7:107780522-107780544 AGGGGGAACAGGACGGTGAGGGG - Intronic
1030502416 7:110376484-110376506 AGGAGGAAGAGAAAAGGGGGAGG + Intergenic
1030746084 7:113167767-113167789 AGATGAGAGAGGGAGGTGGGTGG + Intergenic
1030898823 7:115096431-115096453 AGGTGCCAGAGGAGGCTGGGAGG + Intergenic
1031081615 7:117263779-117263801 AGGTAGAAGAGATAAGTGGGAGG - Intergenic
1031222188 7:118982193-118982215 AGGAGGAGGAGGAGGGGGGGAGG + Intergenic
1032120047 7:129149035-129149057 GGGTGGAGGAGGGAGGTGGTGGG - Intronic
1032247844 7:130228412-130228434 AGGTCAAAGAGGTGGGTGGGAGG + Intergenic
1032748647 7:134813884-134813906 AGCTGGTAAAGGACGGTGGGTGG + Intronic
1032883873 7:136116872-136116894 TGGCTGAAGAGGAAGGAGGGGGG - Intergenic
1033200298 7:139362579-139362601 AGATGGAAAAGGTAGGTAGGAGG + Intronic
1033213996 7:139481057-139481079 ATGTGGAAGAGGAAGACAGGTGG + Intronic
1033804207 7:144936446-144936468 ATGAGGAAGAGGAATGTGGGTGG - Intergenic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1034921596 7:155087764-155087786 AGGAGAAAGAGGAAGATGGAAGG - Intergenic
1034978918 7:155463482-155463504 AGGAGGAGGAGGAAGGAAGGAGG - Exonic
1035070418 7:156140575-156140597 AGGAGAAAGAGGCAGGTGGGGGG + Intergenic
1035189336 7:157152166-157152188 AAGTGGAAGAGAAGGCTGGGAGG + Intronic
1035249170 7:157585734-157585756 AAGAGGAAGAGGAAGAGGGGAGG + Intronic
1035355900 7:158276102-158276124 AGATGGAAGAGGAAGCTGAGAGG - Intronic
1035552984 8:544581-544603 AGGTGGAGGGCGAGGGTGGGCGG - Intronic
1035673272 8:1436385-1436407 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1035679424 8:1477165-1477187 AGATGGGAGAGGAAGTTGCGGGG + Intergenic
1035777151 8:2196786-2196808 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1035987610 8:4452041-4452063 GGGTGGAAGAGGAAGATTAGGGG + Intronic
1036218849 8:6903648-6903670 AGGGGGAAGAGAAAGGATGGGGG + Intergenic
1036243813 8:7100258-7100280 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036256976 8:7213793-7213815 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036309026 8:7672392-7672414 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036360508 8:8073720-8073742 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036408780 8:8479176-8479198 AGGAGGAGAAGGAAGGTGAGCGG + Intergenic
1036468186 8:9022857-9022879 ATAAGGAAGAGGAAAGTGGGTGG - Intronic
1036589286 8:10153334-10153356 AGGAGGGAAAGGAAGGTGGAAGG - Intronic
1036705504 8:11043388-11043410 AGCAGGAAGAGGAGGCTGGGTGG - Intronic
1036760108 8:11502858-11502880 CGGTGGCAGGGGAAGGGGGGTGG + Intronic
1036815583 8:11900295-11900317 AGGTGGAAGGAGCAGGAGGGAGG - Intergenic
1036890463 8:12593247-12593269 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036898031 8:12651165-12651187 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1037219837 8:16504981-16505003 ATGTAGAAGAGGAAAGTTGGTGG + Intronic
1037387566 8:18359907-18359929 AGGCAGAAGAGGAAGATGGAAGG - Intergenic
1037405015 8:18532972-18532994 AGGTGGGCGACGGAGGTGGGTGG + Exonic
1037724833 8:21474516-21474538 AGGAGGCTGAGGAAGGAGGGTGG - Intergenic
1037751451 8:21684939-21684961 TGGTGGAGGAGAAAGCTGGGAGG - Intergenic
1037965290 8:23129336-23129358 AGATGGCAGAGGAGGGTGGCAGG + Intergenic
1037986215 8:23292234-23292256 ACTTGGGAGACGAAGGTGGGAGG - Intronic
1038001590 8:23396372-23396394 AGGTGGGAAGGGAAGGAGGGAGG + Intronic
1038238381 8:25784442-25784464 AGGAGGAGGAAGGAGGTGGGAGG - Intergenic
1038276847 8:26128271-26128293 AGGTGGAGGAGGAAGGAGGGAGG + Intergenic
1038432112 8:27508658-27508680 AGGAGGAAGAGGAAGATAGAAGG + Intronic
1038520832 8:28230698-28230720 ATGTGGAAGAGGAGGGTTTGTGG - Intergenic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1038874151 8:31529383-31529405 AGGAGGAAGAGGAACCTGGTGGG - Intergenic
1038922493 8:32100095-32100117 AGGGGGAAGGGGAAGAGGGGAGG - Intronic
1039277841 8:35952938-35952960 TGGTGAAAGAGTAGGGTGGGGGG - Intergenic
1039435946 8:37559348-37559370 AGGAGGAAGAGGAGGGGGAGAGG + Intergenic
1039575334 8:38619155-38619177 AGGTGGAAGATGGGGGGGGGTGG - Intergenic
1039793111 8:40891245-40891267 AGGGGGAAGGGGGAGGGGGGAGG + Intronic
1040384285 8:46903178-46903200 AGGAGGAAGAGAAAAGAGGGAGG + Intergenic
1040384303 8:46903324-46903346 AGGTGAAACAGGAAGGTGCTGGG - Intergenic
1040506964 8:48057664-48057686 AGGTAGGAGAGGAGGGTGGTAGG + Intronic
1040818334 8:51531904-51531926 ATGTGGATGATGACGGTGGGGGG - Intronic
1041178812 8:55226763-55226785 AGGTATTAAAGGAAGGTGGGAGG - Intronic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041347895 8:56920505-56920527 AGGAGGAAGAGGGAGGGAGGAGG + Intergenic
1041625849 8:60025773-60025795 AGGAGGAAGAGCAAGGTGGCTGG - Intergenic
1041758433 8:61338762-61338784 AGGGGGCAGGGGAAGGTTGGGGG - Intronic
1041846143 8:62331033-62331055 AGGTAGAAGAGGAGGGAGGAAGG - Intronic
1041846154 8:62331126-62331148 GGGTGGAAGAGGAGGGAGGAAGG - Intronic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1042155122 8:65836896-65836918 AGGGGGAGGAGGAAGGAGGATGG - Intronic
1042265264 8:66901996-66902018 AGGAGGCTGAGGCAGGTGGGTGG + Intronic
1042387678 8:68196728-68196750 AGGAGGAAGAGAGAGTTGGGGGG - Intronic
1042504096 8:69541106-69541128 TGGTGGAGCAGGAAGGTGGTGGG + Intronic
1042605887 8:70545985-70546007 TGGTGGAGGTGGGAGGTGGGAGG + Intergenic
1043099381 8:76021299-76021321 AGGAGGAAGAGGAAGAAGAGGGG - Intergenic
1043358048 8:79437040-79437062 AGGTGGGAGAGGAAGGAGGGAGG - Intergenic
1043379528 8:79687704-79687726 AGGTGGAGGTGGAGGGTGGTTGG + Intergenic
1043529655 8:81135352-81135374 AGGGGGAACAGGAAGAAGGGCGG - Intergenic
1044660013 8:94586028-94586050 AGGTGGACGAGCAAGGTGGGTGG + Intergenic
1044661343 8:94594108-94594130 AGGTGGACGACCAAGGTGGGCGG - Intergenic
1044769175 8:95611339-95611361 ACTTGAGAGAGGAAGGTGGGAGG - Intergenic
1044831152 8:96250682-96250704 AGGAGGAGGAGGAGGGGGGGAGG + Intronic
1045085405 8:98677535-98677557 AGGAGGAAGAGGAAGGAAGAAGG + Intronic
1045290001 8:100824966-100824988 AGGTGGAAGGGGAAGGATGAAGG - Intergenic
1045458002 8:102400891-102400913 AAGGGGAAAAGGAAGGTTGGAGG + Intronic
1045555050 8:103207653-103207675 AGGGGGAGGGGGCAGGTGGGAGG + Intronic
1045960065 8:107956707-107956729 TGCTGGAAGAGGAATGGGGGAGG + Intronic
1046053713 8:109054824-109054846 AGGAGGAGGAGGAAGGTTAGGGG - Intergenic
1046547468 8:115669242-115669264 AGGTGGGGGAGGGAGGAGGGGGG - Intronic
1047172632 8:122508790-122508812 AGGTGGAAGAGGAAAGTAAAAGG - Intergenic
1047303398 8:123634179-123634201 AGGAGGGAGAGGAAGGGGGATGG + Intergenic
1047362790 8:124184378-124184400 AGGTGGAAGAAGAATGAGGTTGG + Intergenic
1047426109 8:124748453-124748475 AAGAGCAGGAGGAAGGTGGGTGG + Intergenic
1047432557 8:124805425-124805447 AGAGGGAAGGGGAAGTTGGGAGG + Intergenic
1047527368 8:125645016-125645038 AGGAGGAGGAGGAAGGAAGGTGG - Intergenic
1047628382 8:126679485-126679507 AGGAGGAAGAGGAGGAGGGGAGG + Intergenic
1047907179 8:129484699-129484721 AAGGAGAGGAGGAAGGTGGGAGG - Intergenic
1047938303 8:129803063-129803085 AGGAGGAAGAGCAACGTGGTTGG + Intergenic
1048016458 8:130501615-130501637 AGGTGGGAGAGAGAGGTGGGAGG + Intergenic
1048019218 8:130523015-130523037 GGGTGGAAGAGGTCGGTGGATGG + Intergenic
1048151588 8:131900386-131900408 TGGTGGAAGGGGAAGGGAGGAGG + Intergenic
1048279676 8:133095909-133095931 AGGTGGGTGAGGAAGGCAGGAGG - Intronic
1048997153 8:139801185-139801207 AGGTGCCAGAGGAATGAGGGTGG + Intronic
1049083184 8:140458084-140458106 GGGTGGAGGAGGGAGGAGGGAGG + Intronic
1049096571 8:140551733-140551755 CGGTGGATAAGGTAGGTGGGTGG + Intronic
1049202466 8:141347040-141347062 AGGCGGCAGAGGAAGGTCGGAGG + Intergenic
1049346333 8:142141082-142141104 AGGAGGAAGAGGAAGCAGGAGGG - Intergenic
1049361134 8:142213042-142213064 AGGTGGAGGGGGAAGGGAGGGGG - Intronic
1049575281 8:143386972-143386994 TGGTGGAAGGGGACGGTGGTTGG - Intergenic
1049697146 8:143989995-143990017 GGGTGGGAGGGGCAGGTGGGCGG - Intronic
1049774504 8:144398228-144398250 AGGTGGGTGGGGACGGTGGGGGG - Intronic
1049816675 8:144606343-144606365 AGAAGGAAGAGGAAGGGGGTTGG - Intergenic
1050174404 9:2854847-2854869 AGGTGGAAGTGGGGGGTGGGAGG + Intergenic
1050253704 9:3772268-3772290 AGGTGGAAGAGGAGGTGGGAAGG + Intergenic
1050555250 9:6784249-6784271 AAGTGGAGGAGGCATGTGGGAGG + Intronic
1050847415 9:10239816-10239838 AGGGGCAAGAGGCAGGAGGGCGG - Intronic
1051137546 9:13939653-13939675 TGGTTGAAGGGGAAGGTGAGTGG - Intergenic
1051170381 9:14314698-14314720 AGGAGGAGGAGGAAGGTGGGGGG - Intronic
1051257748 9:15232350-15232372 AGGTGGAAACGGGAGGTGGGGGG + Intronic
1051340286 9:16104169-16104191 AGGTGAAAGTTGAAAGTGGGAGG - Intergenic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1051508009 9:17846595-17846617 TGGTGGAAGGCCAAGGTGGGCGG - Intergenic
1051819872 9:21151920-21151942 ATTTGGAAGACCAAGGTGGGAGG - Intergenic
1051993026 9:23176485-23176507 AGGGGCAGGAGGAAGATGGGAGG - Intergenic
1052069557 9:24065478-24065500 AGGTGGAAGAGAAAGGAGAAAGG + Intergenic
1052074749 9:24127396-24127418 AAGTGGAGGAGGAACGTGGAGGG + Intergenic
1052152403 9:25133275-25133297 AGATGGAAGACGAAGGATGGAGG - Intergenic
1052173327 9:25427804-25427826 AGGTAGAAGGGGAAGGGTGGGGG - Intergenic
1052536595 9:29755698-29755720 AGGTGCAAGGGGCAGGTGGGTGG + Intergenic
1052619389 9:30886093-30886115 AGGTGGAGAAGGTAGATGGGAGG + Intergenic
1052820172 9:33132220-33132242 AGTGGGAAGAGGAGGGAGGGAGG + Intronic
1053143880 9:35699003-35699025 GGGTGGAAGAGGAAGGGAGCAGG + Intronic
1053263591 9:36693943-36693965 AGGAGGAGGAGGAAGGAGAGGGG - Intergenic
1053337276 9:37286908-37286930 AGGTGGGAGGGGAGGGAGGGAGG - Intronic
1053351977 9:37419115-37419137 AGGTGGAGGAGGCAGGAGAGAGG + Intergenic
1053367114 9:37530739-37530761 AGGCGGAGGTGGGAGGTGGGAGG - Intronic
1053382139 9:37657894-37657916 GGATGGAATAGGAAGGTGGTGGG - Intronic
1053559901 9:39181082-39181104 ACTTGGAAGGGGGAGGTGGGAGG + Intronic
1053824010 9:42001303-42001325 ACTTGGAAGGGGGAGGTGGGAGG + Intronic
1053885626 9:42643604-42643626 AGATGGAAGGGGAAAGAGGGTGG - Intergenic
1054137215 9:61437873-61437895 ACTTGGAAGGGGGAGGTGGGAGG - Intergenic
1054224645 9:62451053-62451075 AGATGGAAGGGGAAAGAGGGTGG - Intergenic
1054606563 9:67186060-67186082 ACTTGGAAGGGGGAGGTGGGAGG - Intergenic
1054714839 9:68547025-68547047 TGGGGGAAGAGGAGGGAGGGTGG - Intergenic
1054785588 9:69207030-69207052 AGGAGGCAGAGTATGGTGGGAGG - Intronic
1054850663 9:69843498-69843520 AGGAGGAGGAGGAGGGGGGGAGG - Intronic
1055099190 9:72445672-72445694 AAGTGGAACAAGAAGATGGGAGG + Intergenic
1055424530 9:76180611-76180633 AGGAGGAGGGAGAAGGTGGGTGG - Intronic
1055426826 9:76205226-76205248 AGCTGGAAGCGGGAGGTGGAGGG - Intronic
1055587982 9:77776161-77776183 AGCTGGAAAAGGGAGATGGGAGG - Intronic
1056040522 9:82660705-82660727 AGGAGGAGGAGGAAGGAGGGGGG + Intergenic
1056659488 9:88534259-88534281 AGGAGGAAGAGCACGGTGTGGGG + Intergenic
1056679144 9:88701912-88701934 AGGTGGCTGAGGCAGGAGGGTGG + Intergenic
1056778650 9:89532964-89532986 AGGTGGACAAGGCAGGTGGAAGG + Intergenic
1057226423 9:93295720-93295742 AGGTGGGGGAGGAAGGTGAGGGG - Intronic
1057226747 9:93296726-93296748 AGGAGGAGGAGGAAAGTGAGGGG - Intronic
1057347189 9:94260772-94260794 AGGTGGGGGAAGAAGTTGGGTGG + Intronic
1057390638 9:94639339-94639361 AGGTGCAAGCGGCAGGTGCGGGG + Intronic
1057426110 9:94951023-94951045 TGGTGGAAAAGGAAGGCGTGGGG + Intronic
1057558747 9:96110786-96110808 AGGTGGAAAAGGAAGGGGTAGGG - Intronic
1057931317 9:99195977-99195999 AGAGAGAAAAGGAAGGTGGGAGG - Intergenic
1058139470 9:101342445-101342467 AGGGGGAAGAGGAAGGGGACGGG + Intergenic
1058226719 9:102372803-102372825 AGCTACAAAAGGAAGGTGGGAGG + Intergenic
1058667425 9:107333314-107333336 AGCTGGAAGAAGAGAGTGGGTGG + Intergenic
1058882417 9:109297178-109297200 AGGGAGAAGAGGCAGCTGGGGGG + Intronic
1059354335 9:113687430-113687452 GGGTGGAGGAGGAAGTGGGGAGG + Intergenic
1059794471 9:117677340-117677362 ATTTGGAAGAGGAAGGGGTGGGG + Intergenic
1059929899 9:119250095-119250117 AGGAAGAAAAGGAAGGAGGGAGG + Intronic
1060115397 9:120936402-120936424 GGGTGGGAGATGGAGGTGGGTGG - Intergenic
1060206039 9:121683373-121683395 TGGGGGCAGAGGAAGGAGGGAGG - Intronic
1060297793 9:122355042-122355064 GGAAGGAAGAGGAAGGAGGGAGG + Intergenic
1060355382 9:122902606-122902628 AGGCGGAGGCGGGAGGTGGGTGG + Intronic
1060452393 9:123755489-123755511 AGGTGGAAGAGGAGGAAGGGAGG - Intronic
1060452414 9:123755605-123755627 AGGTGGAAGAGGTGGAAGGGAGG - Intronic
1060556128 9:124507926-124507948 AGGTGGAAGAAGAGGGGGGCCGG + Intergenic
1060683478 9:125586334-125586356 GAGTGGAAGACGCAGGTGGGAGG - Intronic
1060712002 9:125876401-125876423 AGGAGGAAGAGGAAAGGGGTTGG - Intronic
1060724722 9:125999333-125999355 GGGTGGGGGAGGAAGGTGAGGGG + Intergenic
1060728594 9:126022633-126022655 ACGTGGAATAGGAAGAGGGGAGG + Intergenic
1060927188 9:127463254-127463276 AGGTGCAGGAGGCAGGTGGTGGG + Intronic
1060976855 9:127770176-127770198 GGGATGAAGAGGAAGGAGGGAGG - Intronic
1061039065 9:128129143-128129165 AGGAGGAGGATGAAGCTGGGAGG - Intergenic
1061111216 9:128572683-128572705 TGGTAGCAGAGGAAGGTGGGTGG + Intronic
1061204326 9:129154390-129154412 AGGAGGGAGAGGAAGGAGAGGGG + Intergenic
1061251473 9:129428871-129428893 GGGTGGAAGGGGAAGGAGGGTGG - Intergenic
1061274981 9:129564824-129564846 AGGAGGAAGAGGAGAGTAGGAGG - Intergenic
1061899675 9:133666493-133666515 AGGAGGGAGAGGGAGGAGGGAGG - Intronic
1062061663 9:134500052-134500074 AGGAGGAGGAGGAAGGGGGTTGG - Intergenic
1062072185 9:134562187-134562209 AGGTCTACGAGGAAAGTGGGAGG + Intergenic
1062098018 9:134712617-134712639 AGGGGGAACAGGAAGGAAGGGGG - Intronic
1062225076 9:135445621-135445643 AGCTGGAAGGGGATCGTGGGAGG + Intergenic
1062262706 9:135670867-135670889 GGCTGGCAGAGGCAGGTGGGTGG - Intergenic
1062333690 9:136055736-136055758 ACGTGGTAGAGGAAGGAGAGAGG + Intronic
1062566877 9:137167534-137167556 AGGGGGCAGAGGAGGGCGGGCGG - Intronic
1202780775 9_KI270717v1_random:34861-34883 AGGAAGAAGAGGAGGGCGGGAGG - Intergenic
1203787692 EBV:136893-136915 AGGAGGATGAAGAAGGCGGGGGG + Intergenic
1203661867 Un_KI270753v1:52157-52179 AGGTGGAGGAGGAAGGGGCTGGG + Intergenic
1185591524 X:1280643-1280665 AGGAGGAAGAGGAGGAAGGGGGG - Intronic
1185789997 X:2921985-2922007 AGCTTGCAGAGGAAGGTGTGAGG - Exonic
1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG + Intergenic
1186034469 X:5406131-5406153 AGGAGGAAGATGAAGGAGGAAGG + Intergenic
1186124711 X:6400911-6400933 AGGAGGAGGAGGAAGGGGAGGGG - Intergenic
1186198355 X:7131893-7131915 AGGTGGAGGAGGAAGGGCTGAGG - Intronic
1186226041 X:7400171-7400193 GGGAGGTAGAGGCAGGTGGGTGG - Intergenic
1186329253 X:8514691-8514713 AAGTGGAAGAGGGAGGCAGGAGG + Intergenic
1186456218 X:9712112-9712134 AAGAGGAAGAGGCAGGTGGAAGG - Intronic
1186927842 X:14354957-14354979 AACTGGAAGAGGGAAGTGGGAGG - Intergenic
1187686189 X:21817999-21818021 AGGAGGAAGAGAAGGGAGGGAGG - Intergenic
1188256456 X:27966985-27967007 AGGAAGAAGAGGAGGGGGGGGGG - Intergenic
1188801654 X:34538994-34539016 AGGAGGACAAGGAAGGAGGGAGG + Intergenic
1188880671 X:35488242-35488264 GGGTGGAAAAATAAGGTGGGTGG - Intergenic
1188918805 X:35946114-35946136 ATTTGGAAGACGGAGGTGGGAGG - Intronic
1189110596 X:38286083-38286105 AGGGGGAAGAGGAAGGAGAAGGG - Exonic
1189150351 X:38700152-38700174 GAGTGGAAGAAGATGGTGGGGGG - Intergenic
1189205548 X:39235450-39235472 AGGGAAAAGAGCAAGGTGGGGGG - Intergenic
1189364737 X:40379939-40379961 AGGAGGAAGAGGGAGGAGGAAGG - Intergenic
1189571414 X:42301921-42301943 AGGAGAAAGAGGGAGGAGGGAGG - Intergenic
1190123415 X:47682757-47682779 AGGAAGAAGAGGAAGGAAGGAGG - Intergenic
1190268475 X:48844113-48844135 AGGAGGAAGAGGAAATGGGGAGG + Intergenic
1190284742 X:48954655-48954677 AAGGGGAAAAGGAATGTGGGAGG + Intronic
1190332285 X:49243206-49243228 GGGGTGAGGAGGAAGGTGGGGGG + Intronic
1190810786 X:53881451-53881473 AGAAGGAACAAGAAGGTGGGTGG - Intergenic
1191636184 X:63379764-63379786 AGGTGGTAAAAGAAGGAGGGAGG - Intergenic
1191668238 X:63725117-63725139 AGGAGGAGGAGGAAAGGGGGAGG - Intronic
1191967362 X:66774527-66774549 AGGAAGAAAAGGAAGGAGGGAGG - Intergenic
1192032243 X:67525920-67525942 AGGCTGGAGAGGAAGGTGGATGG + Intergenic
1192141499 X:68650450-68650472 AGGAGGAAGAGGAGGAGGGGAGG + Intronic
1192173092 X:68868716-68868738 TGGTGGAAGAGGAGGTGGGGAGG + Intergenic
1192218452 X:69180142-69180164 AGGTGGAAGATGGTGGTGAGTGG - Intergenic
1192318620 X:70070568-70070590 AGGTGGAGGCGGAAGGGGCGAGG - Intergenic
1192459950 X:71308457-71308479 AGGAGGAGGAGGAAGATGAGGGG + Intergenic
1192473407 X:71419318-71419340 AGTGGGAACAGGGAGGTGGGAGG - Intronic
1192847990 X:74925480-74925502 AGGAGGAAGGGGGAGGAGGGGGG - Intronic
1193085499 X:77445441-77445463 AGGTGGAAAAGGAAGGGAAGAGG - Intergenic
1193103023 X:77637015-77637037 AGGAGGAAGAAGAAGGAAGGAGG + Intronic
1193154496 X:78158390-78158412 GGGTGGAAGAGGCAGCAGGGAGG + Intergenic
1193178695 X:78427320-78427342 AGGTGGAAGAGGAGTATGGGGGG + Intergenic
1193509256 X:82379086-82379108 AGGTGGAAGAGAGAGAGGGGAGG + Intergenic
1193716063 X:84935760-84935782 AGGTGGAAGATGAAGGTGTGGGG - Intergenic
1194659783 X:96617966-96617988 AGTTGGAAGGGGAATGAGGGAGG - Intergenic
1194802715 X:98291978-98292000 ACGTTGAAGAGGCAGCTGGGCGG - Intergenic
1194809438 X:98372707-98372729 AGGTGGGTGAGGAAGTTGGTAGG + Intergenic
1194950420 X:100119662-100119684 AAGTGGAAGAGTCAGGAGGGAGG - Intergenic
1195117979 X:101718802-101718824 AGGTGCAAAAGGAAAGAGGGAGG - Intergenic
1195217205 X:102713342-102713364 AGGTGGGGATGGAAGGTGGGGGG - Intronic
1195551454 X:106176027-106176049 AAGAGGAAGAGGAAGTTGCGGGG + Intronic
1195557210 X:106240839-106240861 AGGTGAAGAAGGAAGGAGGGAGG + Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195884385 X:109624511-109624533 AGTTGGGGGTGGAAGGTGGGAGG + Exonic
1195942120 X:110175316-110175338 AGTTGGAAGGGGATTGTGGGAGG + Exonic
1195966645 X:110435105-110435127 GGGGGGAGGAGGAAGGAGGGAGG + Intronic
1196375148 X:115025518-115025540 ATGTGGAATTGGAAGGGGGGTGG - Intergenic
1196421526 X:115527102-115527124 AGGTGGGAGGCTAAGGTGGGAGG - Intergenic
1196591482 X:117490385-117490407 GGGTGGAAGATGAATGTGGAGGG - Intergenic
1196657333 X:118232206-118232228 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1197699712 X:129589786-129589808 AGGTGGAAGATGAAAGTAAGAGG - Intronic
1198126140 X:133645823-133645845 ATGTGGAAGATGAGAGTGGGTGG + Intronic
1198200099 X:134407898-134407920 AGGTGGAAGTAGAAGGTGAAAGG + Intronic
1198213175 X:134533790-134533812 AGGTAGAAGAGGAAGATGGAAGG + Intergenic
1198229146 X:134673191-134673213 AGGAAGAAGAGGAAAGAGGGAGG + Intronic
1198256721 X:134930607-134930629 GGGTGGGAGAGGAAGGTAGGAGG - Intergenic
1198379339 X:136069441-136069463 ACGTGGGAGAGTAAGGTGGGAGG + Intergenic
1198432763 X:136584419-136584441 GGGTATAAGAAGAAGGTGGGGGG - Intergenic
1198810783 X:140534179-140534201 TGGAAGAAGAGGAAGGAGGGAGG + Intergenic
1199074174 X:143510859-143510881 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199093168 X:143714120-143714142 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199215167 X:145254040-145254062 AGGTGGAGAAGGAAGGGGGATGG + Intronic
1199640795 X:149858948-149858970 AGGTGGCAGTGCAAGGTGGTGGG - Intergenic
1199715747 X:150506329-150506351 AGGAGGAGGAGGAAGGGGAGGGG - Intronic
1199802889 X:151268922-151268944 AGGGGAATGAGGCAGGTGGGTGG - Intergenic
1199880584 X:151971607-151971629 AGTTGGAATTGGAGGGTGGGTGG + Intronic
1199944434 X:152653927-152653949 GCGTGGAAGGGGAATGTGGGTGG + Exonic
1200044227 X:153392512-153392534 CAGTGGCAGAGGAAAGTGGGAGG + Intergenic
1200185088 X:154177120-154177142 AGCTAGGAGAGGGAGGTGGGGGG + Intergenic
1200190741 X:154214258-154214280 AGCTAGGAGAGGGAGGTGGGGGG + Intergenic
1200196492 X:154252060-154252082 AGCTAGGAGAGGGAGGTGGGGGG + Intergenic
1200202147 X:154289178-154289200 AGCTAGGAGAGGGAGGTGGGGGG + Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200258697 X:154600031-154600053 AGGGGGAAGAGCAAGGTGGAGGG + Intergenic
1200293566 X:154894719-154894741 AGGGGGGGTAGGAAGGTGGGGGG - Intronic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic
1200963859 Y:9018945-9018967 GGGTGTCAGAGGAAGGTGGCTGG + Intergenic
1201284315 Y:12365957-12365979 AGCTTGCAGAGGAAGGTGTGAGG + Intergenic
1201341104 Y:12935510-12935532 AGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1201344249 Y:12965526-12965548 CGGTGGAAGAAGCAGGTGAGTGG + Intergenic
1201595997 Y:15669917-15669939 GGGAGGTAGAGGCAGGTGGGTGG - Intergenic
1201705710 Y:16934357-16934379 AGGTTGAAGAGGTAGATAGGAGG + Intergenic