ID: 1051492614

View in Genome Browser
Species Human (GRCh38)
Location 9:17683427-17683449
Sequence AAACTCTAGGCTCAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051492599_1051492614 28 Left 1051492599 9:17683376-17683398 CCCTGTTTCTCTTGTGGAACAAA 0: 1
1: 0
2: 0
3: 21
4: 286
Right 1051492614 9:17683427-17683449 AAACTCTAGGCTCAGGGGACAGG No data
1051492600_1051492614 27 Left 1051492600 9:17683377-17683399 CCTGTTTCTCTTGTGGAACAAAA 0: 1
1: 0
2: 2
3: 24
4: 319
Right 1051492614 9:17683427-17683449 AAACTCTAGGCTCAGGGGACAGG No data
1051492607_1051492614 3 Left 1051492607 9:17683401-17683423 CCTTAAGCTCCTGGGGGAAGGGC 0: 1
1: 0
2: 1
3: 36
4: 263
Right 1051492614 9:17683427-17683449 AAACTCTAGGCTCAGGGGACAGG No data
1051492609_1051492614 -6 Left 1051492609 9:17683410-17683432 CCTGGGGGAAGGGCGGCAAACTC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1051492614 9:17683427-17683449 AAACTCTAGGCTCAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051492614 Original CRISPR AAACTCTAGGCTCAGGGGAC AGG Intronic
No off target data available for this crispr