ID: 1051493979

View in Genome Browser
Species Human (GRCh38)
Location 9:17698171-17698193
Sequence CTGCATCTGGACTTGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051493979_1051493984 19 Left 1051493979 9:17698171-17698193 CCTGGCTTCAAGTCCAGATGCAG 0: 1
1: 0
2: 1
3: 29
4: 199
Right 1051493984 9:17698213-17698235 GTCAACATCTTAAGGCCTCCAGG No data
1051493979_1051493983 11 Left 1051493979 9:17698171-17698193 CCTGGCTTCAAGTCCAGATGCAG 0: 1
1: 0
2: 1
3: 29
4: 199
Right 1051493983 9:17698205-17698227 TCACTTTGGTCAACATCTTAAGG No data
1051493979_1051493982 -3 Left 1051493979 9:17698171-17698193 CCTGGCTTCAAGTCCAGATGCAG 0: 1
1: 0
2: 1
3: 29
4: 199
Right 1051493982 9:17698191-17698213 CAGGCAGTCACTTGTCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051493979 Original CRISPR CTGCATCTGGACTTGAAGCC AGG (reversed) Intronic
900896212 1:5484641-5484663 CTGCATCTGGCTTTGAACCCGGG - Intergenic
901301614 1:8203598-8203620 CAGAATCTGGCCTTGAAGCCTGG + Intergenic
901442135 1:9284435-9284457 CAGCACCTGGAATTGAACCCAGG - Intergenic
902398707 1:16145822-16145844 CTGCATCAGGATCTGAATCCAGG - Intronic
902775673 1:18673116-18673138 CTGGGTCAGGACTTGAACCCAGG - Intronic
903546745 1:24128923-24128945 ATGAGTCTGGACTGGAAGCCAGG - Intronic
904825243 1:33269989-33270011 CTGAGTCTGAACTTGAAACCGGG - Intronic
906177471 1:43787218-43787240 CTGCCTCTGGCCTGGGAGCCAGG + Intronic
906717230 1:47979278-47979300 CTGCATGTGTACTCAAAGCCAGG + Intronic
907518085 1:55006063-55006085 CAGACTCTGGGCTTGAAGCCCGG - Intronic
907589031 1:55647933-55647955 TTGGAACTGGACTTCAAGCCAGG - Intergenic
907776097 1:57516834-57516856 TTGCAGCTGGACTTGAAGTGGGG - Intronic
908875310 1:68667719-68667741 TGGCATGTGGACTTGAACCCAGG - Intergenic
909330861 1:74408744-74408766 TTGCATTTGGATTTGAAGCAGGG - Intronic
910859619 1:91731181-91731203 TTCCATGTGGACTTGAACCCTGG - Intronic
912722450 1:112031597-112031619 CTGAATTGGGACTTGAATCCAGG + Intergenic
912797061 1:112699769-112699791 CTGGATCTGGACTTTAATCTGGG + Exonic
913352992 1:117883048-117883070 CAGAATTTGGACTTGAACCCAGG - Intronic
914508372 1:148308925-148308947 CTTCATCGGGAATTGAACCCGGG + Intergenic
915564217 1:156704991-156705013 CTGCATCCAGACTGGGAGCCCGG - Intronic
916520878 1:165562640-165562662 CAGAATCTGGATTAGAAGCCTGG + Intronic
917094488 1:171386354-171386376 CTGCATCTAGATTTGAATCATGG - Intergenic
918522307 1:185428151-185428173 ATGCATCTGAATTTGAATCCTGG + Intergenic
919495484 1:198261300-198261322 CAGAATCAGGACTTGAAGCCAGG - Intronic
920178975 1:204120887-204120909 CAGCATCAGGATTTGAACCCAGG - Intronic
922173194 1:223174535-223174557 CAGTATCTGGATTTGAACCCAGG - Intergenic
922325089 1:224521023-224521045 TTGCATGTGGACGTGATGCCTGG - Intronic
922412851 1:225392585-225392607 GGGCATTTGGACTTGAAGCAGGG - Intronic
923409788 1:233695590-233695612 ATGCCTCTGGAGTTGAAGTCAGG - Intergenic
1063105454 10:2987999-2988021 CTGCATCTGGCCTTGGAGGCTGG + Intergenic
1063493203 10:6484101-6484123 CAGCATCTTGACTTGAATTCTGG - Intronic
1064749291 10:18510196-18510218 CTGTATCTGGACATGAGGGCTGG - Intronic
1064947438 10:20806531-20806553 CTGCATCTGGCCTTGATGTCAGG - Intronic
1065440467 10:25748635-25748657 CTGCCTTTGGACTTGAACTCAGG - Intergenic
1065848522 10:29766558-29766580 CAGCATCAGGACTTGAAGCAAGG + Intergenic
1067552096 10:47243464-47243486 CTGCATCTGAATTTGAACCCAGG + Intergenic
1070501916 10:77080461-77080483 CTGCATCAGGACCAGCAGCCAGG + Intronic
1070886336 10:79903832-79903854 CTGTGACAGGACTTGAAGCCTGG + Intergenic
1071603940 10:86971904-86971926 CAGCATCTGGACTGGCAGCCAGG - Intronic
1072784771 10:98272250-98272272 CTGCCTCTGGCCTTGCACCCTGG + Intergenic
1074049919 10:109872324-109872346 CAGCATCTGGCCTTGGAGCCAGG + Intronic
1074215164 10:111377088-111377110 CTGCATCTGGAAATGAAGGAAGG + Intergenic
1077564114 11:3285557-3285579 CTGCATCTGGTGCTGAAGTCTGG + Intergenic
1077570004 11:3331374-3331396 CTGCATCTGGTGCTGAAGTCTGG + Intergenic
1077699137 11:4423792-4423814 CTGCAACTGGACCTGTAGCCTGG - Intergenic
1078017999 11:7631870-7631892 CAGAATATGGACTTGAACCCAGG + Intronic
1078145254 11:8718069-8718091 CTGCTTCTGGACTTGGAGCCAGG - Intronic
1078147588 11:8732193-8732215 CTGCATATGGATTTGGAGCTGGG - Intronic
1079054533 11:17194233-17194255 CTGAAGCTGGAGTTGCAGCCTGG - Intronic
1079552459 11:21716504-21716526 CTGCCTCTGAACATGAAGCCAGG + Intergenic
1080318609 11:30979545-30979567 CAGCATCTAGACCTGAAGGCTGG - Intronic
1080412209 11:32036356-32036378 CAGCACCTGGACTTGAATCCAGG + Intronic
1081038798 11:38184020-38184042 CTGGAAGTGGACTTGATGCCTGG - Intergenic
1081572602 11:44301049-44301071 CTGCCTCTGGACCTGAAGGCAGG + Intronic
1081975894 11:47234570-47234592 CAGCATCTGGTTTTGTAGCCTGG + Exonic
1084270157 11:68024986-68025008 CTGCTTCTGGAGTTGGAGCAGGG - Intronic
1084426264 11:69086000-69086022 CTGCATCTGCACTGGACGCCCGG + Intronic
1085714597 11:78861398-78861420 CTGCAGCTGGAATTGAACTCAGG + Intronic
1086114794 11:83237481-83237503 CTGCATGTGGATTAGAAGGCTGG + Intronic
1086555371 11:88104101-88104123 CTGAATCTCAACTTGAAGCAAGG + Intergenic
1088376470 11:109146824-109146846 TTGCATCTTGTCTTTAAGCCTGG - Intergenic
1088811174 11:113393719-113393741 CTCCACCTGGACCTCAAGCCGGG + Exonic
1088859137 11:113783644-113783666 CTGAGTCAAGACTTGAAGCCAGG + Intergenic
1092255556 12:6925166-6925188 CTGCAGCTGGACTATAAGCCTGG + Intronic
1094266341 12:28564728-28564750 CTGAAGCTGGAGTTGCAGCCTGG + Intronic
1095640037 12:44476967-44476989 GTGCCTCTGTACTTGAAACCAGG + Intergenic
1097309609 12:58104069-58104091 CTGAAGCTGGACTTGAACTCTGG + Intergenic
1097985431 12:65777980-65778002 CTGCATCTCCACTTGAGCCCTGG - Intergenic
1100235233 12:92654140-92654162 CTGAGTCTGGATTTGAACCCAGG + Intergenic
1102268577 12:111509967-111509989 CTGCCTCTGATCTTGAAGCCTGG + Exonic
1103146620 12:118600641-118600663 CAGCACCAGGACTTGAACCCAGG + Intergenic
1103201769 12:119093661-119093683 CAGAATCAGGACTTGAACCCAGG + Intronic
1106357009 13:28992484-28992506 CTGCACATGGACTAGAAGCAGGG + Intronic
1107832407 13:44385964-44385986 CTGCAACTGAACATGCAGCCGGG - Intronic
1107972800 13:45660292-45660314 CTGCATCTAGGCTTTAAGACTGG + Intergenic
1108021970 13:46136876-46136898 CTTCATCAGGAGTTGCAGCCCGG + Intronic
1109371447 13:61425231-61425253 CAGAATGGGGACTTGAAGCCAGG - Intronic
1113793556 13:113043416-113043438 CTGCCTTTGGACTCCAAGCCAGG - Intronic
1118361578 14:65061813-65061835 CTGCCTCTCGACTTGCACCCTGG + Exonic
1121919314 14:97865992-97866014 CTGCATCAGATCTTGAGGCCGGG + Intergenic
1125120592 15:36154217-36154239 ATGCATCTTGTCTTGAATCCTGG + Intergenic
1126118905 15:45233636-45233658 TTCCATCTGGCCTTGGAGCCAGG - Intergenic
1126532643 15:49727825-49727847 CAGAATCTGTATTTGAAGCCAGG + Intergenic
1127628618 15:60804489-60804511 CAGCATCTGAATCTGAAGCCAGG + Intronic
1129824199 15:78624074-78624096 GGGCATCTGGACTTGAAGGAGGG + Intergenic
1135589473 16:23694906-23694928 GTGCACCGGGACCTGAAGCCAGG - Exonic
1138458620 16:57134996-57135018 CAGCAGCTGGCCTTGAATCCAGG - Intronic
1138554021 16:57761865-57761887 CTGAGTCAGGACTTGCAGCCAGG + Intronic
1139256400 16:65547039-65547061 ATTCTTCTGGACTTGAATCCTGG - Intergenic
1139338828 16:66253754-66253776 CTGCCTCTGGACTTGGACTCAGG + Intergenic
1139339944 16:66261990-66262012 CTCCATCTGGGCTGGGAGCCTGG + Intergenic
1139368207 16:66446880-66446902 CTGCATCTGGACCTGTGCCCAGG + Intronic
1140194804 16:72847423-72847445 CTGCATCTGGCCCTGAACCTAGG + Intronic
1140741827 16:77948215-77948237 CAGCCTCTGCCCTTGAAGCCAGG - Intronic
1143253695 17:5540570-5540592 CTGCACCAGGATTTGAAGCCAGG - Intronic
1143277548 17:5722938-5722960 TTGCCTCTGGAATTGAATCCAGG + Intergenic
1143585230 17:7847528-7847550 CTGCTTCTACACTTGCAGCCCGG + Exonic
1144268092 17:13590986-13591008 CTGAATCTGGAATTGGAGCAAGG - Intronic
1146929354 17:36766795-36766817 CTGCACGTGGACTAGAATCCAGG + Intergenic
1148847456 17:50537808-50537830 CTGAAGCAGGACTTGAACCCAGG - Intronic
1149188354 17:54029124-54029146 CTGCAGCTTTATTTGAAGCCTGG - Intergenic
1150489858 17:65566752-65566774 CTGCACCTGGCCTTGAAGATGGG - Intronic
1151355415 17:73555271-73555293 CTGGAACTGGCCTTGAAGGCTGG + Intronic
1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG + Intergenic
1152881332 17:82817585-82817607 CTGCACCTGGCCTTCATGCCTGG + Intronic
1155537716 18:26834072-26834094 GGACATCTGGACTTGAATCCAGG + Intergenic
1160598779 18:79996605-79996627 CTTCTTCTAGAATTGAAGCCAGG + Intronic
1161727189 19:5936330-5936352 CTGCATGTGGAGATGACGCCAGG - Intronic
1161804327 19:6433710-6433732 CTGCTTAGGGATTTGAAGCCAGG - Exonic
1162301866 19:9849078-9849100 CTGCATCTGACCTGGGAGCCAGG - Exonic
1162876017 19:13621653-13621675 CTGCATTTGAACTTGAGGCTGGG - Intronic
1163256350 19:16158169-16158191 CAGCACCAGGATTTGAAGCCAGG + Exonic
1165351672 19:35279192-35279214 CTGCAGCTGGGCTCGAAGCAGGG - Exonic
1166673004 19:44722718-44722740 GGGCATCTGGATTTGAACCCAGG + Intergenic
1167559060 19:50214655-50214677 CTGCATCTGAATTTGAACACTGG + Intronic
1168074055 19:53969560-53969582 CAGCATCTGGATTTGAATCCAGG + Intronic
1168726592 19:58586240-58586262 GGCCATCTGGACATGAAGCCTGG - Intergenic
925631378 2:5897013-5897035 CTGCCTCTGGACTTGAACTCAGG + Intergenic
925670098 2:6302123-6302145 CAGCATCCTGATTTGAAGCCTGG + Intergenic
926292558 2:11542341-11542363 CTGCATCTGCTCTTGGAGCTTGG + Intronic
928213824 2:29344415-29344437 ATACATCTGGCCTTGGAGCCTGG + Intronic
931650960 2:64468334-64468356 GTTCCTCTGGACTTGAGGCCGGG - Intergenic
931942360 2:67266604-67266626 CTCCTTGTGGATTTGAAGCCTGG - Intergenic
932304070 2:70689138-70689160 AAGCATCTGAACTAGAAGCCAGG + Intronic
932558028 2:72842748-72842770 CAGCATCTTGACCTGAGGCCTGG - Intergenic
936390106 2:112064721-112064743 CTGCACCTGGCTGTGAAGCCTGG + Intronic
941013323 2:160326062-160326084 ATGTAGCTGGAATTGAAGCCAGG + Intronic
942595206 2:177585774-177585796 CTGCACCTGGACCAGAGGCCTGG - Intergenic
947967550 2:234294228-234294250 ATGCACCTGGACAGGAAGCCTGG - Intergenic
1169053955 20:2604632-2604654 CTGCATCTGGGCTGGCTGCCAGG + Intronic
1172188088 20:33044021-33044043 CTGATGCTGGACTTGAAGCTGGG + Exonic
1172484685 20:35291186-35291208 CTGCAGCTGGGCCTGAAGCAGGG - Intronic
1172700972 20:36853386-36853408 CTCCAACTGGACCTGAATCCTGG - Intronic
1172867119 20:38108800-38108822 CTGCATCCGGGCTCAAAGCCAGG + Intronic
1173620299 20:44431129-44431151 CTGAGTCAGGACTTGAACCCAGG + Exonic
1174078245 20:47953015-47953037 CTGAATCAGGACTTGAACCCAGG - Intergenic
1174696453 20:52564567-52564589 CAGCATCAGGATTTGAACCCAGG + Intergenic
1177525021 21:22279509-22279531 CTCTTTCTGGACTTGATGCCTGG - Intergenic
1181054382 22:20253149-20253171 CTGCATCTGGGCTGGAAGAGGGG + Intronic
1181533376 22:23529727-23529749 AAGCATCAGGACTTGAACCCAGG + Intergenic
1181553407 22:23653799-23653821 CTGCGTCTGGCCTTGAAGTTGGG + Intergenic
1182893574 22:33839916-33839938 ATGCATCTGGGTTTGAAGCCTGG - Intronic
1183207320 22:36428428-36428450 TGGCATCTGGCTTTGAAGCCAGG - Intergenic
1184655149 22:45937326-45937348 CAGGGTCTGGACTTGAAGGCAGG - Intronic
1185165436 22:49259333-49259355 CAGAATCAGGACTCGAAGCCTGG - Intergenic
1185206784 22:49543848-49543870 TTGCATCTGGATGTGATGCCTGG - Intronic
1185388664 22:50547800-50547822 CTGCAGCTGGACTTGGGGCTGGG - Intergenic
949120336 3:376326-376348 TTGCATTTGAACATGAAGCCTGG - Intronic
950326984 3:12120230-12120252 CAGGATCTGGACTAGAACCCAGG + Intronic
950527021 3:13530191-13530213 CTGAATCAGGACTTGAACCCAGG - Intergenic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
950787096 3:15445973-15445995 ACACATCTGGATTTGAAGCCTGG - Intronic
951844154 3:27067488-27067510 ATGCATCTGGCTTTGAATCCTGG - Intergenic
951994701 3:28714250-28714272 CTGCACCTGGCCTGGAAACCGGG + Intergenic
952981349 3:38738593-38738615 CTGCATCTAGACTTGAAGAGAGG - Intronic
954861755 3:53696256-53696278 CTGTGTCTGGCCTTGTAGCCTGG + Intronic
955693014 3:61608445-61608467 CTGCATCTTTCCTTGAAGCCTGG + Intronic
956144774 3:66181680-66181702 GGGGATCTGGATTTGAAGCCTGG - Intronic
956495292 3:69819315-69819337 CTGCATCTGGACATTTAGCAGGG - Intronic
959616732 3:108357168-108357190 CTGCAGGTAGACTGGAAGCCAGG + Intronic
960972473 3:123149775-123149797 AGTCATCTGGACTTGAACCCAGG + Intronic
963102849 3:141622799-141622821 TTGCATGTGGACTTGAAGGATGG - Intergenic
968020142 3:195378568-195378590 CCGCACCTGGCCTTGAAGCAAGG - Intronic
968703033 4:2065611-2065633 CTGCACGTGGCCTTGATGCCTGG - Exonic
969302135 4:6303425-6303447 CTCCAGCTGGAGATGAAGCCAGG - Intergenic
969549443 4:7854876-7854898 CTTCATCCGCACTTGAAGCTGGG + Intronic
970924383 4:21434102-21434124 CAGCATCTGGGTTTGAATCCTGG - Intronic
972010214 4:34169727-34169749 CTTCAACTGGACTTGAAGGCTGG + Intergenic
973255813 4:48112107-48112129 CAGCATCAGGATGTGAAGCCAGG + Intronic
975650656 4:76589522-76589544 TTGCTTCTGCACTGGAAGCCTGG + Intronic
976624271 4:87162346-87162368 CTACATATTGATTTGAAGCCAGG - Exonic
976677897 4:87723651-87723673 CTGAATCTGTAGTTGAAGCAGGG - Intergenic
980039288 4:127920792-127920814 CAGCATCTGGAAGTGGAGCCCGG - Exonic
989170954 5:38469920-38469942 CTGCCTCTGGCCTGGAAGCTGGG + Intergenic
993688255 5:90967181-90967203 CTGGATCTGGATTTGAATTCTGG + Intronic
993876650 5:93315224-93315246 ATGTAACTGGACTTGAAGCAGGG - Intergenic
999375789 5:151085731-151085753 CTGGATCTGGGCTTGCATCCAGG + Intronic
1000628640 5:163567002-163567024 CTGCATTTGGTTTTGAATCCTGG + Intergenic
1001922202 5:175609546-175609568 CAGCATCCGGCCTTGAACCCTGG + Intergenic
1003480567 6:6528354-6528376 CTGCTGCTGGACTTAAAACCTGG + Intergenic
1003507217 6:6750026-6750048 CTGCAGCTGGGATTGAAGGCTGG - Intergenic
1007281187 6:40713626-40713648 CTCCCTGAGGACTTGAAGCCAGG - Intergenic
1008890451 6:56482761-56482783 CTGCATCTGGACCTTGACCCAGG + Exonic
1011957835 6:93045277-93045299 CTGCCTCTGGAAGTGAAGACTGG - Intergenic
1012274359 6:97253748-97253770 CTGCAGCTGGACTAGATACCTGG + Intronic
1015129608 6:129794588-129794610 CTGCTTCTGGATCTGAAGGCTGG - Intergenic
1018256396 6:161924003-161924025 CTGTGTCTGGACTTGAATCCAGG + Intronic
1019186185 6:170221723-170221745 TTGCATTTGGACTTTTAGCCTGG + Intergenic
1019493567 7:1325962-1325984 CCGCGTCTGGACTTGAACCCAGG - Intergenic
1020688685 7:11327708-11327730 CTGCCTTTGTACTTGAAACCAGG - Intergenic
1022807644 7:33838720-33838742 CTGCATCTGCACTCCAGGCCTGG - Intergenic
1023747206 7:43332531-43332553 CTGTGTCTGGACCTGCAGCCAGG + Intronic
1028270926 7:88788177-88788199 CTGCATGAGGACTGGAGGCCAGG + Intronic
1030523124 7:110622557-110622579 CTGCCTCTGGACTTGCAGTTAGG - Intergenic
1031395025 7:121263255-121263277 CTCCAGCAGGACTTGAAGCATGG - Intronic
1032715256 7:134503788-134503810 CTGCATCTGGAAGTCCAGCCAGG - Intergenic
1034948200 7:155277861-155277883 CTGCAACTGGAATTAAAGTCAGG + Intergenic
1038826530 8:31008806-31008828 CAGAATTTGGACTTGAACCCAGG + Intronic
1039494278 8:37969021-37969043 CTGCCTCTCCACTTGAACCCTGG - Intergenic
1039590595 8:38743459-38743481 CTGCAGCTGAACTTTAGGCCTGG + Intronic
1041200624 8:55450057-55450079 CTGCATGGCGCCTTGAAGCCCGG - Intronic
1047683783 8:127282629-127282651 CAGGATCTGGATTTGAATCCAGG - Intergenic
1049237067 8:141517738-141517760 CTGGATCTGACCTTGAAGCTGGG + Intronic
1049433546 8:142576077-142576099 CTGCTCCAGGACTTCAAGCCTGG + Intergenic
1049825916 8:144667678-144667700 TGGCACCTGGACTTGAATCCTGG + Intergenic
1051493979 9:17698171-17698193 CTGCATCTGGACTTGAAGCCAGG - Intronic
1055097736 9:72431357-72431379 CAGCAGCGGGACTTGAATCCAGG - Intergenic
1055320132 9:75075368-75075390 TTGCATCTTGAGTTGCAGCCAGG - Intronic
1055978204 9:81974908-81974930 TTTTATCTGCACTTGAAGCCTGG - Intergenic
1056130814 9:83584757-83584779 CAGAATCTGGACTAGAACCCAGG - Intergenic
1056817935 9:89815249-89815271 CTGCCTCTGGGCTTGCAGCCTGG + Intergenic
1057409601 9:94806102-94806124 CTGCATCTTGCCTTGAAATCAGG - Intronic
1057466746 9:95321148-95321170 CTGTAAATGGAGTTGAAGCCAGG - Intergenic
1059730384 9:117051410-117051432 CTAGATCTGGATTTGAATCCTGG - Intronic
1059890639 9:118798124-118798146 CTGCATATGGACTTGAGTTCTGG - Intergenic
1060524478 9:124312698-124312720 CTGCATCTGGACGGGGTGCCCGG + Intronic
1060723403 9:125992695-125992717 GTGGACCTGGACTTGAACCCAGG - Intergenic
1061247093 9:129406113-129406135 AAGCATCAGGACTTGAATCCAGG - Intergenic
1062065412 9:134523956-134523978 CTGCATGTGGACTGGATCCCAGG - Intergenic
1062065620 9:134524726-134524748 CTGCATGTGGACTGGATCCCAGG - Intergenic
1062143449 9:134973246-134973268 CTGCGTGTGCACTTGACGCCCGG - Intergenic
1062616522 9:137399096-137399118 CTGCACCTCCACTGGAAGCCTGG + Intronic
1187415741 X:19092052-19092074 CTGCATGTGAACTAGAATCCAGG + Intronic
1190214601 X:48471212-48471234 CTGGATCTGAACCTGAATCCAGG + Intergenic
1190320214 X:49175666-49175688 CTGCATCGTGGCTTGAAGGCAGG - Exonic
1192150594 X:68709969-68709991 CAGCATCAGGATTTGAACCCTGG + Intronic
1192338163 X:70239121-70239143 CAGGATCTGGACTAGAACCCAGG - Intronic
1194650136 X:96504392-96504414 CAGCACCTGGACTTGAATCTAGG - Intergenic
1196466529 X:115977468-115977490 CTTCATCTGTGCTTGAAGTCTGG - Intergenic
1197025266 X:121740290-121740312 CTGCATCTGGATTTGGAGACAGG + Intergenic