ID: 1051500808

View in Genome Browser
Species Human (GRCh38)
Location 9:17775829-17775851
Sequence CTGATGCACTTGGGCAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051500808_1051500814 7 Left 1051500808 9:17775829-17775851 CCTGTTCTGCCCAAGTGCATCAG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1051500814 9:17775859-17775881 CATCAACTCACACCAAGGGTGGG No data
1051500808_1051500815 8 Left 1051500808 9:17775829-17775851 CCTGTTCTGCCCAAGTGCATCAG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1051500815 9:17775860-17775882 ATCAACTCACACCAAGGGTGGGG No data
1051500808_1051500817 13 Left 1051500808 9:17775829-17775851 CCTGTTCTGCCCAAGTGCATCAG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1051500817 9:17775865-17775887 CTCACACCAAGGGTGGGGGTTGG No data
1051500808_1051500816 9 Left 1051500808 9:17775829-17775851 CCTGTTCTGCCCAAGTGCATCAG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1051500816 9:17775861-17775883 TCAACTCACACCAAGGGTGGGGG No data
1051500808_1051500813 6 Left 1051500808 9:17775829-17775851 CCTGTTCTGCCCAAGTGCATCAG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1051500813 9:17775858-17775880 TCATCAACTCACACCAAGGGTGG No data
1051500808_1051500811 2 Left 1051500808 9:17775829-17775851 CCTGTTCTGCCCAAGTGCATCAG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1051500811 9:17775854-17775876 GTGTTCATCAACTCACACCAAGG No data
1051500808_1051500812 3 Left 1051500808 9:17775829-17775851 CCTGTTCTGCCCAAGTGCATCAG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1051500812 9:17775855-17775877 TGTTCATCAACTCACACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051500808 Original CRISPR CTGATGCACTTGGGCAGAAC AGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
904246584 1:29192406-29192428 TTGATGCCCTCGGGCAGAACTGG + Intergenic
905641605 1:39593859-39593881 CTGAAGCAATTGAGCAGGACTGG - Intergenic
908444487 1:64188368-64188390 CTGAAGCGCCTGGGCAGGACTGG - Intergenic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
910454751 1:87385551-87385573 CTCTTGCACTTGAGCAGAACAGG + Intergenic
911611643 1:99964975-99964997 CTGAGGTAATTGGCCAGAACTGG + Intergenic
917310446 1:173672689-173672711 GTGATGCACCTAGGCAGACCAGG + Intergenic
917450782 1:175145783-175145805 ATGATGCACTGGGGCAGAGGAGG - Intronic
917480328 1:175406310-175406332 CTGCAGCACCTGGGCTGAACTGG + Exonic
920613375 1:207464753-207464775 CTGAAGCACTTTGGCAGTAGAGG - Intronic
920875423 1:209829951-209829973 CACATGCACTTGGGCAGGGCTGG - Intronic
921172304 1:212560310-212560332 CTTCTGCACTTGGGCAGATCTGG - Intergenic
923956804 1:239031518-239031540 CTGAGGCACCTGGGGAGAGCTGG + Intergenic
1064549204 10:16481591-16481613 CTAATGCTCTCAGGCAGAACTGG - Intronic
1067465496 10:46495230-46495252 AAGATGGACTTGGGCAGAGCAGG + Intergenic
1067621691 10:47889371-47889393 AAGATGGACTTGGGCAGAGCAGG - Intergenic
1068589520 10:58839224-58839246 CTGATGGACTAGGACAGAGCAGG + Intergenic
1070605444 10:77895084-77895106 CTGATGGACTTGGTCAGACTGGG - Intronic
1073250340 10:102117345-102117367 CAGTTGCACAGGGGCAGAACAGG + Intronic
1073426100 10:103456558-103456580 GAGAAGCACTTGGGCAGATCAGG + Intronic
1075263862 10:120984414-120984436 CTTATGGACTTGGGCAGAAGAGG - Intergenic
1077059112 11:609986-610008 CTCCTGCAGGTGGGCAGAACAGG + Intronic
1079792897 11:24761251-24761273 CAGCTTCACATGGGCAGAACAGG + Intronic
1081597880 11:44471772-44471794 CTGATGCTCCTGTCCAGAACTGG + Intergenic
1082944166 11:58740522-58740544 CAGGTGCACATGGGAAGAACTGG + Intergenic
1083799722 11:65039642-65039664 CTGAGGCACCTGGGCACCACTGG - Intronic
1087514652 11:99142629-99142651 CTGATAGACCTGGACAGAACAGG - Intronic
1089628772 11:119770447-119770469 CTGATGTGCTAGGGCAGAAGTGG + Intergenic
1091385673 12:93179-93201 GTGATCCACTTGTGGAGAACTGG + Intronic
1094348444 12:29497493-29497515 CTGAGGCATTTGGGAAGAAAGGG - Intronic
1099436926 12:82657005-82657027 CTGATGGACTTGAGCTGAAGGGG - Intergenic
1100061439 12:90581378-90581400 CTGTTGCACTTGAGAAGAGCTGG - Intergenic
1107274355 13:38660916-38660938 CTGAAGAAGTTAGGCAGAACTGG - Intergenic
1117395172 14:55301794-55301816 CTGAGCCACTTGGTCAGGACAGG + Intronic
1118720881 14:68593067-68593089 CTGAGGCACCAGGTCAGAACTGG + Intronic
1118787245 14:69056121-69056143 ATGTTGCAGTTGGGCAGAAGTGG - Intronic
1120142875 14:80947861-80947883 TTGATGCCTATGGGCAGAACAGG - Intronic
1122018979 14:98820762-98820784 CTGATGCTCTTGGGGAAAATGGG - Intergenic
1125414403 15:39437638-39437660 CTGATTCCCTTTGGCAGAACAGG + Intergenic
1126031962 15:44507759-44507781 ATGATTCTATTGGGCAGAACTGG - Intronic
1131682526 15:94738871-94738893 CTGGTACAATTGGGCAGAAAAGG - Intergenic
1136051061 16:27650323-27650345 TAGGTGCACTGGGGCAGAACAGG + Intronic
1142017527 16:87758409-87758431 CTGATGAACTTGGACATACCAGG + Intronic
1146274644 17:31509125-31509147 CTGAGGCTCTTGGGCAGATTTGG - Intronic
1149541574 17:57471818-57471840 CTGATGCTCTGGGGCAGAAGTGG - Intronic
1151380954 17:73725502-73725524 CTGACACACTTGGGCAGAGTTGG + Intergenic
1151638684 17:75372441-75372463 GTGAAGCCCTTGGGCAGAATTGG - Intronic
1152503150 17:80726404-80726426 CTGCTGCACTAGGACAGCACTGG - Intronic
1155667678 18:28331058-28331080 CTAATGAAGTTGGGAAGAACTGG + Intergenic
1156700691 18:39820862-39820884 CTGCTGACCTTGGGCTGAACTGG + Intergenic
1156997545 18:43485692-43485714 CTGGAGCACCTGGGCAGGACTGG - Intergenic
1160067283 18:75587453-75587475 CTGGTGAACTTGGGCACAACTGG - Intergenic
1164552155 19:29220896-29220918 CTGGTGGACTTGGGCAGACCTGG + Intergenic
925891824 2:8440536-8440558 CTGAAGCCCTTGGGCAGGAAAGG - Intergenic
925990717 2:9252003-9252025 CAGATGTACTTGGGAAGTACTGG + Intronic
927432652 2:23040212-23040234 CACATGCACTGGGGGAGAACAGG + Intergenic
930529318 2:52571460-52571482 CTGATGCACCTGGGCATCAGCGG + Intergenic
930841624 2:55853805-55853827 CTGATACACTTGGGTAGATGAGG - Intergenic
931049450 2:58394268-58394290 TGGATGCACTTGGGTAAAACAGG - Intergenic
938644404 2:133316244-133316266 CTGATTCACTTTGGTAGAATAGG - Intronic
941130619 2:161645489-161645511 CTAATTCACTTGGGGAAAACTGG - Intronic
948834705 2:240620408-240620430 CTGCTGCAGGTGGGCAGAGCTGG + Intronic
948965416 2:241375990-241376012 CTGATGCAGTTGTGGAGGACAGG - Intronic
949009751 2:241671733-241671755 CTGGTTCACTTGGGCACCACTGG + Intronic
1169174934 20:3502684-3502706 CTGAGGCAGGTTGGCAGAACTGG + Intronic
1169811583 20:9613910-9613932 GTGATGCACTGGGTCAGAAACGG - Intronic
1170392275 20:15888729-15888751 CTAAGCCACTTGGGCAGAATGGG + Intronic
1173254941 20:41387562-41387584 CGGATGCCCCTGGGCAGCACGGG + Intergenic
1174907984 20:54572758-54572780 CTGTTGCACTTGTGCAGACTTGG + Intronic
1175967063 20:62665048-62665070 CTGAGGCACTCAGGCTGAACTGG - Exonic
1180608994 22:17083937-17083959 TGGATGCACTAGGGCAGGACGGG + Intergenic
1180926822 22:19560979-19561001 CTCATGCACATGCACAGAACTGG - Intergenic
1183466243 22:37981788-37981810 CCTCTGCTCTTGGGCAGAACTGG + Intronic
1183729451 22:39609632-39609654 CTAGTGCATTTGGCCAGAACTGG + Intronic
949722873 3:7010956-7010978 CTCATGCACTTTGAGAGAACTGG - Intronic
952111052 3:30124290-30124312 CTGCTGCACCTGGGAAGGACAGG + Intergenic
952698124 3:36294676-36294698 CTGAGGTACATGTGCAGAACAGG + Intergenic
954404867 3:50340064-50340086 CTGATTCACTGGGTCAGAAAAGG + Intronic
956655319 3:71544560-71544582 CTGAAGCACTTGGGAAGGAATGG + Intronic
961059941 3:123820185-123820207 CTGTTGTAGTTGGGCAGAACAGG + Intronic
963298087 3:143569169-143569191 CTGATGGACTTGGAAATAACAGG - Intronic
965396132 3:168162256-168162278 CTAATGCACTTTGGCAAATCAGG - Intergenic
966512668 3:180781622-180781644 CTGTTGGACCTGGACAGAACAGG - Intronic
968185132 3:196627847-196627869 CTGATTCACTTGAGCAGGAAAGG + Intergenic
968292103 3:197546890-197546912 CTGATGCCCTGGGGCACCACAGG - Intronic
971924463 4:32989523-32989545 CTGCTTCACTAGGTCAGAACTGG - Intergenic
973152726 4:46908534-46908556 GTGTTGCACTCTGGCAGAACTGG - Intronic
974026890 4:56740902-56740924 CTGATGCTCTTGGGCTGACGAGG + Intergenic
979576160 4:122294288-122294310 CTCATCCAGTTGGGCAGAATGGG - Intronic
980387105 4:132100998-132101020 CTGCTGCACCTGGGCAGAGTAGG + Intergenic
981908737 4:149953648-149953670 TTGATGCATTTGGGCAGCAGAGG + Intergenic
984029292 4:174583326-174583348 CTGAGTCTCTTGGGGAGAACAGG + Intergenic
995299264 5:110558630-110558652 CTGTTGGACTTGTACAGAACAGG - Intronic
1002942874 6:1733422-1733444 TTGATGCCTTTTGGCAGAACAGG + Intronic
1006227425 6:32551410-32551432 CTGATGCACATGGGAAGAAAAGG - Intergenic
1006229953 6:32577453-32577475 CTGAGGCACATGGGAAGAAAAGG - Intronic
1007303588 6:40887246-40887268 TTGCTTCACTTGGGCAGAATGGG + Intergenic
1008715026 6:54278319-54278341 CATGTGCACTTGAGCAGAACGGG - Intergenic
1014910085 6:127081412-127081434 CTCATGCAGTTGGGGAGAAGGGG + Intergenic
1016723326 6:147328282-147328304 CTGGTCCAGTTGGGCAGGACAGG - Intronic
1017757266 6:157540031-157540053 CTGTTGCACTTGGACAAATCAGG - Intronic
1019563337 7:1668394-1668416 CGGCTGCACTTGGCCAGCACAGG + Intergenic
1019690627 7:2409180-2409202 ATGATGCACCTGGGCAGAGAAGG + Intronic
1020049343 7:5071869-5071891 CTGTTGCACTGGGGCTGGACTGG + Intronic
1020543593 7:9493730-9493752 CTGCTGGTCATGGGCAGAACAGG - Intergenic
1031118054 7:117689708-117689730 CTGGTGTATTTGGGAAGAACAGG + Intronic
1033558607 7:142510033-142510055 CACATTCACTTGGGCAGCACAGG - Intergenic
1034471170 7:151255125-151255147 CTGATGCAATTGGGGATAAAGGG - Intronic
1037537641 8:19840341-19840363 CAGATACACGTGGGGAGAACTGG - Intronic
1038778899 8:30554387-30554409 CAGATAAACTTGGGCAGCACAGG + Intronic
1040060989 8:43102631-43102653 CTGGGGCACTGGGACAGAACTGG - Intronic
1040595212 8:48831900-48831922 CAGAGGCACTTGGGCAGCCCAGG - Intergenic
1041124397 8:54621060-54621082 CTGATTCGCTTGGCCACAACAGG - Exonic
1048095794 8:131292192-131292214 CTTATGAACTTGGGCAGTATGGG + Intergenic
1048124204 8:131614796-131614818 GTGATACACTTGGGGATAACAGG - Intergenic
1050106775 9:2174044-2174066 CTGCTGTACGTGGGCATAACTGG - Intronic
1051500808 9:17775829-17775851 CTGATGCACTTGGGCAGAACAGG - Intronic
1052298109 9:26921438-26921460 ATGATGGACTAGGCCAGAACTGG - Intronic
1059245406 9:112845495-112845517 CTTCTCCACTTTGGCAGAACTGG + Intronic
1062629339 9:137456805-137456827 CTGTTTCCCTTGGGCAGAAGAGG + Intronic
1190168439 X:48092436-48092458 CTGTTGCTCTTGGGCAGAGAAGG - Intergenic
1190168804 X:48095249-48095271 CTGTTGCTCTTGGGCAGAGAAGG + Intergenic
1190283462 X:48946665-48946687 AGGATGGACTTGGGCATAACTGG - Intronic
1192310393 X:70008108-70008130 CTGATGCAATAGGCAAGAACAGG - Intronic
1195303671 X:103557456-103557478 CTCATGCAGTGGGGCAGATCTGG + Intergenic
1195971700 X:110480459-110480481 CTGTTGGACTTGAACAGAACAGG - Intergenic
1197177419 X:123500591-123500613 CTGTTGGACCTGGACAGAACAGG - Intergenic
1197331374 X:125157106-125157128 CTGGTGCAATTGGTCAGAATGGG - Intergenic
1198768855 X:140106971-140106993 ATGATCCACTAAGGCAGAACTGG - Intergenic
1200761343 Y:7042023-7042045 ATGATGCACTGGGGGAGAAAAGG + Intronic