ID: 1051501386

View in Genome Browser
Species Human (GRCh38)
Location 9:17781665-17781687
Sequence TCTCAAATACTGCTGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051501386 Original CRISPR TCTCAAATACTGCTGGTAGG AGG (reversed) Intronic
901179857 1:7334286-7334308 TCACAAATACTCTTGGAAGGAGG + Intronic
903499862 1:23794973-23794995 CCTCCAATACTGCTGCCAGGGGG - Exonic
903999399 1:27330427-27330449 TCTCATTCACTGCTGGTGGGAGG - Intronic
904305860 1:29589536-29589558 TCTCATGAACTGCTGGTGGGAGG + Intergenic
904332585 1:29771913-29771935 TCTCATACACTGCTGGTGGGAGG + Intergenic
904581520 1:31547619-31547641 TCTCAAATGCTGCTGAGACGTGG + Intergenic
905290937 1:36921303-36921325 GGTCAAATGCAGCTGGTAGGTGG - Intronic
906671675 1:47659823-47659845 TCTCAAATGTTGTTGGTGGGAGG + Intergenic
908097555 1:60755236-60755258 ACTCATATGCTGCTGGTGGGAGG - Intergenic
910519924 1:88108723-88108745 TTTTAAAAACTGCTGGTAAGAGG + Intergenic
912360712 1:109092685-109092707 TCCCAAAAATTGCTTGTAGGAGG - Intronic
916022920 1:160809720-160809742 TCTCAAACATTGCTGGTGGGAGG - Intronic
916510273 1:165467126-165467148 TCTCAACTACTCCAGGAAGGAGG - Intergenic
918205611 1:182306393-182306415 TCTCATATTCTGCTGGTAGGTGG - Intergenic
921270555 1:213465562-213465584 TCTCATAAACAGCTGATAGGTGG + Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
924404926 1:243732789-243732811 TCTCAAAGGCTGCTGTTTGGAGG - Intronic
1064168963 10:13012576-13012598 GCTTATATACTGCTGGTGGGAGG + Intronic
1065184411 10:23157927-23157949 TCTAAACTACAGCTGGTCGGTGG - Intergenic
1065193393 10:23236513-23236535 TCTCAAAGATTGCTGGTGTGAGG + Intronic
1067780461 10:49199778-49199800 CCTCATATACTGCTGGTAGGAGG + Intergenic
1069909464 10:71750681-71750703 TCAGAGAAACTGCTGGTAGGAGG + Exonic
1070852420 10:79576545-79576567 TGTCAAATACTGCTGATAGAAGG - Intergenic
1071436942 10:85656206-85656228 TGTCAAATGCTACTGGTTGGAGG - Intronic
1071700591 10:87929240-87929262 TCTCAAATATTACTGTTAAGAGG - Intronic
1071801202 10:89063159-89063181 TATCAGACACTGCTGGTATGGGG - Intergenic
1072076918 10:91985593-91985615 TCTCACATACTGATGGTCAGAGG - Intronic
1072834402 10:98695660-98695682 TCCCAATGACTGCTGCTAGGGGG - Intronic
1073537209 10:104288476-104288498 TTTCACATACTGCTGGTGAGGGG - Intronic
1073856331 10:107679049-107679071 TCCCAACTGCTGCTTGTAGGAGG + Intergenic
1074246294 10:111697144-111697166 ATTCAAACACTGCTGTTAGGGGG - Intergenic
1077338998 11:2017710-2017732 TCTCTAACACTGCTGGAGGGCGG - Intergenic
1078521613 11:12068435-12068457 CATAAAATACTTCTGGTAGGGGG - Intergenic
1080674494 11:34412251-34412273 TTTCAAATACTGCTAGTAGTTGG - Intergenic
1081713550 11:45233279-45233301 TCTCCAACACTCCGGGTAGGAGG - Intronic
1082055235 11:47809308-47809330 TCTCATATACTGCTGGTGCTGGG + Intronic
1083143542 11:60740607-60740629 TCTCAAATTCTGCTCCTGGGAGG - Intronic
1084778002 11:71389858-71389880 TCTCAAAGACTGCCTGAAGGAGG - Intergenic
1085805364 11:79630946-79630968 TCTCATACACTGCTGGTGGGAGG + Intergenic
1086017945 11:82190105-82190127 TTTCAAATACTTCTTGTATGAGG + Intergenic
1088306132 11:108410156-108410178 ACTCATATATTGCTGGTGGGGGG - Intronic
1088715550 11:112546090-112546112 TCTTAAAGACTCCTGGGAGGTGG + Intergenic
1089871423 11:121675959-121675981 TCTCATACACTGCTGACAGGAGG - Intergenic
1091225313 11:133953594-133953616 ACTCAGATCCTGCTGGTAGTTGG - Intronic
1202821982 11_KI270721v1_random:72892-72914 TCTCTAACACTGCTGGAGGGCGG - Intergenic
1101893596 12:108737142-108737164 ACTCATAGATTGCTGGTAGGTGG - Intergenic
1102391674 12:112553938-112553960 TCTCAAAAAATGCTGGGAGATGG - Intergenic
1105956555 13:25288233-25288255 TCTCAAATGGTGGTGGTGGGGGG + Intergenic
1106024643 13:25945355-25945377 TCTCAAAAACTGCTGGCAGAAGG + Intronic
1106732662 13:32557546-32557568 TCTCATATATTGCTGGTAGAAGG - Intergenic
1108457096 13:50627240-50627262 TCTCACGCATTGCTGGTAGGAGG + Intronic
1110796144 13:79640653-79640675 TCTCATCCACTGCTGGTAGGAGG - Intergenic
1112297822 13:98203883-98203905 ACTCATATACTGCTGGTTGCTGG - Intronic
1115085439 14:29509410-29509432 TGGCAAATACTGCTGGTCTGGGG + Intergenic
1115216600 14:31019579-31019601 TCTCAAAGAATTCTGGCAGGAGG + Intronic
1115891633 14:38036612-38036634 ACACAAATGCTCCTGGTAGGTGG - Intronic
1117946732 14:61034092-61034114 TCTGAGTTACTGCTGGGAGGAGG + Intronic
1126448472 15:48778448-48778470 TCTAATAAACTGCTGGTGGGTGG + Intronic
1126779755 15:52129341-52129363 TCTCACCTCCCGCTGGTAGGAGG - Intronic
1126782673 15:52151657-52151679 ACTCACATACTGCTGTTGGGAGG - Intronic
1126929868 15:53635535-53635557 TTTCAAATGCTGCTGTTAAGTGG + Intronic
1128313981 15:66648530-66648552 TCTCAAAAACTCCTGAGAGGGGG + Intronic
1128637187 15:69310354-69310376 TCTCATCCACTGCTGGTAGGTGG - Intronic
1133858250 16:9569924-9569946 TTTTATATACTGCTGGAAGGAGG + Intergenic
1134319443 16:13149415-13149437 TCTCAATCTCTGCTGGTAAGTGG - Intronic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1140112828 16:72018284-72018306 TCTCAGATAGTCCTGGTAGCAGG + Intronic
1140562981 16:76005665-76005687 TAAGAAATACTGCTGGGAGGAGG - Intergenic
1141590340 16:85064510-85064532 TCTCAAACACTGCTGGAATAGGG - Intronic
1142912399 17:3105804-3105826 TCTCATACACTGCTGGCAGTAGG - Intergenic
1144275276 17:13661370-13661392 TCTCATTTATTGCTTGTAGGAGG - Intergenic
1144601642 17:16620262-16620284 TATGAAATACTTCTGCTAGGAGG - Intergenic
1148217894 17:45843730-45843752 ACTCAAATACTGGTGAGAGGTGG - Intergenic
1149312667 17:55410273-55410295 TCTCAAATCCTGCTTGTAAAAGG + Intronic
1152532649 17:80928895-80928917 TCTCAGACACTGTTGGTGGGTGG + Intronic
1153211339 18:2768390-2768412 TCCCATATACTGCTGGTGAGAGG + Intronic
1153577839 18:6540549-6540571 TTTCAAATACTGTTGGTGTGTGG + Intronic
1156271968 18:35543677-35543699 TCTCATATGATGCTGGTAGGGGG - Intergenic
1163026721 19:14517218-14517240 GCGGAAATACTGTTGGTAGGGGG - Intronic
1165654238 19:37519320-37519342 TCTCTTACACTGCTGGTAGGAGG - Intronic
925511359 2:4629286-4629308 CATCAAATATTGCTGGTAGAGGG - Intergenic
927509987 2:23638509-23638531 GCTCAGATACTGCTCCTAGGTGG - Intronic
929337162 2:40762976-40762998 TCTACAATACTGCTAGTAAGCGG + Intergenic
930728404 2:54705351-54705373 TCACAAATCTTGCTGGTAGCTGG - Intergenic
932548598 2:72742575-72742597 TATCAAATGCTGCTATTAGGTGG - Intronic
932962950 2:76436698-76436720 TCTCAAATCCTCCTGGTAGGAGG - Intergenic
935395077 2:102599052-102599074 TCTCATCTATTGCTGGTAGGAGG - Intergenic
935538568 2:104323041-104323063 TATCTCATACTGTTGGTAGGAGG + Intergenic
939112918 2:138029488-138029510 TGTAAAATACTGCTAGTAGATGG - Intergenic
940284572 2:152020799-152020821 TCTGAAACACTGCTGGAAGCAGG + Intronic
941893331 2:170605150-170605172 TGTCAAATGCTGCTGAGAGGCGG - Intronic
945791509 2:214310984-214311006 TCCCAAAAAATGCTGGAAGGAGG + Intronic
946299827 2:218815909-218815931 TCTCACATACAGCTGAGAGGAGG + Intergenic
947831003 2:233141686-233141708 TCTCCAAGACTACTGTTAGGTGG + Intronic
1168851249 20:978564-978586 TCTCAAAAACTGCTCTCAGGGGG + Intronic
1169847738 20:10013838-10013860 TTTCAAATTCTGCTGGTCTGAGG - Intronic
1171071712 20:22075450-22075472 TCTCATGCACTGCTGGCAGGAGG - Intergenic
1173275921 20:41582056-41582078 TCCCAAAAACTGTTGGTGGGAGG + Intronic
1174126026 20:48307232-48307254 TCTCTAACACTGCTGGTGGGGGG - Intergenic
1175356265 20:58371121-58371143 CCTCAGATACTGCTGTTAGAGGG + Intergenic
1175587374 20:60152772-60152794 TCTCATATGTTGCTGGCAGGAGG - Intergenic
1180656966 22:17430003-17430025 TCTCATACACTGTTGGTGGGGGG - Intronic
1181866375 22:25859015-25859037 TTTCTAATACTGTTGATAGGAGG + Intronic
1181995089 22:26871468-26871490 TCTCATCTACTGTTGGTGGGAGG - Intergenic
1182157756 22:28091688-28091710 ACTCAAATACTTGTGGGAGGAGG - Intronic
1184708847 22:46235570-46235592 ACTCAAATGCTGGGGGTAGGTGG + Exonic
950040974 3:9918949-9918971 TCCCATACACTGCTGGTAGGAGG - Intronic
950925978 3:16742388-16742410 TCTTATACACTGCTGGTGGGGGG - Intergenic
951137496 3:19120505-19120527 TGTCTAATATTGATGGTAGGGGG - Intergenic
951466905 3:23010782-23010804 TCTTGAACACTGGTGGTAGGTGG + Intergenic
951742792 3:25942797-25942819 TCTCATCTACTGCTGGTGGGAGG - Intergenic
952333948 3:32389040-32389062 TCGCAGGTACTGCTGGTTGGGGG + Intergenic
953779310 3:45852205-45852227 TCTTAAAAACTGTTGATAGGAGG + Intronic
955124126 3:56093126-56093148 TCTCAAATACTCCTGGAGGATGG + Intronic
956931818 3:74052313-74052335 TCACAAAAACTGCTGGGAGAAGG - Intergenic
957811744 3:85230685-85230707 TCTCAGATACTGCTTGTATAAGG + Intronic
958518868 3:95158312-95158334 TCTCATATAATGCTGGTAAGTGG + Intergenic
961696826 3:128711072-128711094 GCCCAAATACAGCTGGTAGCAGG - Intergenic
962462360 3:135625973-135625995 TCACAAATACTGGAGGGAGGTGG - Intergenic
967649720 3:191972357-191972379 TCTCAAACATTGCTGGCAAGAGG + Intergenic
968795965 4:2704657-2704679 ACTCAGATGCTGCTGGTGGGTGG - Intronic
974002900 4:56528987-56529009 TCTCAAAAACTGCAGAAAGGAGG - Intergenic
976540633 4:86271126-86271148 TCTCAAATACTGCCAAGAGGAGG - Intronic
978569077 4:110116842-110116864 TGTCAAATGCTGCTGCTAGCAGG - Intronic
979401023 4:120249783-120249805 TCTCAAGAACAGCTGGTAGAAGG - Intergenic
980282912 4:130743425-130743447 TCTCAAATACTTTAGGTAGTAGG + Intergenic
981655281 4:147105445-147105467 TCTAACATTCTCCTGGTAGGGGG + Intergenic
981730697 4:147894216-147894238 TCTCATACACTGCTGATGGGAGG - Intronic
981876122 4:149548101-149548123 TTTTAAATACTGATGCTAGGAGG - Intergenic
986869937 5:12034008-12034030 TCTGAAATAATGTTGGGAGGTGG + Intergenic
992055398 5:72983993-72984015 TCTCAAATAAGGATGGAAGGTGG - Intronic
992842289 5:80707791-80707813 TCTCACACACTGCTGAGAGGAGG - Intronic
993518321 5:88865191-88865213 TTTAAAATACTGATGTTAGGTGG - Intronic
995770255 5:115662068-115662090 TCACAGATACTCCTGATAGGAGG - Intergenic
997839435 5:137225758-137225780 TGTCTAATACTGCTGGTACAGGG + Intronic
1000599373 5:163253552-163253574 TCTCAAAAACTACAGGTAGGTGG + Intergenic
1002189422 5:177471026-177471048 TCACACATACTTCTGGTATGCGG - Intronic
1002528049 5:179826069-179826091 TCTGAAAGAATGCTGCTAGGAGG + Intronic
1003271592 6:4612569-4612591 TCTGAAATACTGTTGCTAAGTGG - Intergenic
1005360378 6:25025519-25025541 GCACAAATAGTGCTGGGAGGGGG - Intronic
1005462761 6:26084757-26084779 TCTCATACACTGCTGATAGGAGG + Intergenic
1006327499 6:33365284-33365306 CCTCCAATACTGCTGCCAGGGGG + Intergenic
1007407415 6:41642971-41642993 TCTCTAACACTGCGGGGAGGAGG + Intronic
1007825505 6:44597173-44597195 CCTCATACACTGCTGGTAGGGGG - Intergenic
1009795193 6:68457179-68457201 TCTCATATACTGCTAGGGGGAGG - Intergenic
1011599030 6:89042857-89042879 TGTCAAATGCTGCTGACAGGTGG + Intergenic
1013045023 6:106477004-106477026 TACCAAATACTTATGGTAGGTGG - Intergenic
1013847768 6:114475078-114475100 ACTCATATACTGCTGGTGGCAGG + Intergenic
1013889196 6:115005618-115005640 TCTCAAATACCTCTAATAGGTGG - Intergenic
1018862764 6:167722932-167722954 TCTCAGAAAGTGCTGGTAGGAGG + Intergenic
1020962932 7:14828546-14828568 TCTCAGATAGTACTGGTAGCAGG - Intronic
1022951622 7:35344489-35344511 TCTCATATATTGCTGGTGGGAGG + Intergenic
1023310559 7:38882223-38882245 TGTCAAATGCTGCTGAGAGGAGG - Intronic
1023756366 7:43421815-43421837 TCTCCAACTCTGCTGATAGGAGG + Intronic
1028074229 7:86491866-86491888 TCTCCAATGCTGCTGGTTGGTGG + Intergenic
1030333410 7:108297353-108297375 TCACAAATTCTGCTAGCAGGAGG - Intronic
1031491376 7:122393812-122393834 TCTAAAATTCTCCTGGCAGGTGG + Intronic
1031789167 7:126078464-126078486 TCTCATAAACTGCTGGTGGAAGG - Intergenic
1032974218 7:137203214-137203236 TCTCAACTACTTCAGGTAAGGGG + Intergenic
1033109965 7:138564951-138564973 TCTGAAATACTCCTGCGAGGGGG - Intronic
1035705602 8:1672101-1672123 TCCCAGATACTGCGGTTAGGAGG + Intronic
1036196948 8:6726815-6726837 TCCCAAATCCTGCTGGGATGAGG - Intronic
1037837855 8:22224743-22224765 TCTCAAATACAGTAGATAGGAGG + Intronic
1040755044 8:50762894-50762916 TCCCCAATGCTGCTGGTAGGAGG - Intronic
1044755134 8:95453617-95453639 TCTCATACACTGCTGGTGGAAGG - Intergenic
1051501386 9:17781665-17781687 TCTCAAATACTGCTGGTAGGAGG - Intronic
1051877356 9:21806453-21806475 TCCCAGATACTGCTGGTTAGGGG + Intronic
1053154399 9:35765755-35765777 TCTCATATAATGCTGGTAAGTGG - Intergenic
1053318129 9:37070313-37070335 ACTCATACACTGTTGGTAGGAGG - Intergenic
1055508472 9:76971278-76971300 CCTCCAATACTGCTGCCAGGGGG - Intergenic
1056318338 9:85413553-85413575 TCTTATATACTGCTGGTGAGAGG - Intergenic
1059673717 9:116516478-116516500 TCTCAAATATGGCAGATAGGAGG + Intronic
1059862690 9:118482564-118482586 TGTCACATACTGCTGGAGGGAGG + Intergenic
1186675273 X:11809835-11809857 TCTCATATATTGCTGGTGTGTGG - Intergenic
1188281529 X:28275937-28275959 TCTCATATACTGCTGGTGGTAGG - Intergenic
1189593146 X:42536836-42536858 ACTCACACACTGTTGGTAGGAGG + Intergenic
1189954390 X:46262882-46262904 TCTCAACTCCTCATGGTAGGGGG + Intergenic
1192254693 X:69445908-69445930 TCTTATACACTGCTGGTGGGAGG - Intergenic
1192775659 X:74241889-74241911 TCTGAAATGTTGCTGGGAGGAGG - Intergenic
1195137392 X:101922775-101922797 TCTCAAATAGTGGGGGTTGGGGG - Intronic
1196375290 X:115026510-115026532 TGTCAAAAGCTGCTGATAGGTGG + Intergenic
1197236731 X:124074532-124074554 TATCATATGCTGCTGGAAGGAGG - Intronic
1199543856 X:148986635-148986657 TCCCAAATACTGCTCCTTGGGGG + Intronic