ID: 1051504741

View in Genome Browser
Species Human (GRCh38)
Location 9:17814550-17814572
Sequence GACACAGAGATGGGAACAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051504735_1051504741 15 Left 1051504735 9:17814512-17814534 CCTACTTGTGAGTGGGAGCTAAA No data
Right 1051504741 9:17814550-17814572 GACACAGAGATGGGAACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051504741 Original CRISPR GACACAGAGATGGGAACAAT AGG Intergenic
No off target data available for this crispr