ID: 1051512671

View in Genome Browser
Species Human (GRCh38)
Location 9:17896486-17896508
Sequence AAATTTGTGAGCAAACATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051512671_1051512673 -2 Left 1051512671 9:17896486-17896508 CCTGTATGTTTGCTCACAAATTT No data
Right 1051512673 9:17896507-17896529 TTCTTTTTTACCCTTGTGGAAGG No data
1051512671_1051512675 0 Left 1051512671 9:17896486-17896508 CCTGTATGTTTGCTCACAAATTT No data
Right 1051512675 9:17896509-17896531 CTTTTTTACCCTTGTGGAAGGGG No data
1051512671_1051512679 11 Left 1051512671 9:17896486-17896508 CCTGTATGTTTGCTCACAAATTT No data
Right 1051512679 9:17896520-17896542 TTGTGGAAGGGGACGGAAACAGG No data
1051512671_1051512674 -1 Left 1051512671 9:17896486-17896508 CCTGTATGTTTGCTCACAAATTT No data
Right 1051512674 9:17896508-17896530 TCTTTTTTACCCTTGTGGAAGGG No data
1051512671_1051512676 4 Left 1051512671 9:17896486-17896508 CCTGTATGTTTGCTCACAAATTT No data
Right 1051512676 9:17896513-17896535 TTTACCCTTGTGGAAGGGGACGG No data
1051512671_1051512672 -6 Left 1051512671 9:17896486-17896508 CCTGTATGTTTGCTCACAAATTT No data
Right 1051512672 9:17896503-17896525 AAATTTCTTTTTTACCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051512671 Original CRISPR AAATTTGTGAGCAAACATAC AGG (reversed) Intergenic
No off target data available for this crispr