ID: 1051512673

View in Genome Browser
Species Human (GRCh38)
Location 9:17896507-17896529
Sequence TTCTTTTTTACCCTTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051512670_1051512673 -1 Left 1051512670 9:17896485-17896507 CCCTGTATGTTTGCTCACAAATT No data
Right 1051512673 9:17896507-17896529 TTCTTTTTTACCCTTGTGGAAGG No data
1051512671_1051512673 -2 Left 1051512671 9:17896486-17896508 CCTGTATGTTTGCTCACAAATTT No data
Right 1051512673 9:17896507-17896529 TTCTTTTTTACCCTTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051512673 Original CRISPR TTCTTTTTTACCCTTGTGGA AGG Intergenic
No off target data available for this crispr