ID: 1051513881

View in Genome Browser
Species Human (GRCh38)
Location 9:17907543-17907565
Sequence GACCCTGGGAGGATTCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051513881_1051513891 -4 Left 1051513881 9:17907543-17907565 CCCCTCCGAATCCTCCCAGGGTC No data
Right 1051513891 9:17907562-17907584 GGTCTTCTCCAGGGCCACACGGG No data
1051513881_1051513898 14 Left 1051513881 9:17907543-17907565 CCCCTCCGAATCCTCCCAGGGTC No data
Right 1051513898 9:17907580-17907602 ACGGGGTGTATAAGGAACTGGGG No data
1051513881_1051513890 -5 Left 1051513881 9:17907543-17907565 CCCCTCCGAATCCTCCCAGGGTC No data
Right 1051513890 9:17907561-17907583 GGGTCTTCTCCAGGGCCACACGG No data
1051513881_1051513901 29 Left 1051513881 9:17907543-17907565 CCCCTCCGAATCCTCCCAGGGTC No data
Right 1051513901 9:17907595-17907617 AACTGGGGACTTCTCCAGGGTGG No data
1051513881_1051513897 13 Left 1051513881 9:17907543-17907565 CCCCTCCGAATCCTCCCAGGGTC No data
Right 1051513897 9:17907579-17907601 CACGGGGTGTATAAGGAACTGGG No data
1051513881_1051513894 6 Left 1051513881 9:17907543-17907565 CCCCTCCGAATCCTCCCAGGGTC No data
Right 1051513894 9:17907572-17907594 AGGGCCACACGGGGTGTATAAGG No data
1051513881_1051513896 12 Left 1051513881 9:17907543-17907565 CCCCTCCGAATCCTCCCAGGGTC No data
Right 1051513896 9:17907578-17907600 ACACGGGGTGTATAAGGAACTGG No data
1051513881_1051513899 25 Left 1051513881 9:17907543-17907565 CCCCTCCGAATCCTCCCAGGGTC No data
Right 1051513899 9:17907591-17907613 AAGGAACTGGGGACTTCTCCAGG No data
1051513881_1051513900 26 Left 1051513881 9:17907543-17907565 CCCCTCCGAATCCTCCCAGGGTC No data
Right 1051513900 9:17907592-17907614 AGGAACTGGGGACTTCTCCAGGG No data
1051513881_1051513892 -3 Left 1051513881 9:17907543-17907565 CCCCTCCGAATCCTCCCAGGGTC No data
Right 1051513892 9:17907563-17907585 GTCTTCTCCAGGGCCACACGGGG No data
1051513881_1051513902 30 Left 1051513881 9:17907543-17907565 CCCCTCCGAATCCTCCCAGGGTC No data
Right 1051513902 9:17907596-17907618 ACTGGGGACTTCTCCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051513881 Original CRISPR GACCCTGGGAGGATTCGGAG GGG (reversed) Intergenic
No off target data available for this crispr