ID: 1051517739

View in Genome Browser
Species Human (GRCh38)
Location 9:17949596-17949618
Sequence CATAGCACTGAGAACTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051517739_1051517741 13 Left 1051517739 9:17949596-17949618 CCAGCCTAGTTCTCAGTGCTATG No data
Right 1051517741 9:17949632-17949654 GTTTCTGTCTTATTGCTCACAGG No data
1051517739_1051517742 21 Left 1051517739 9:17949596-17949618 CCAGCCTAGTTCTCAGTGCTATG No data
Right 1051517742 9:17949640-17949662 CTTATTGCTCACAGGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051517739 Original CRISPR CATAGCACTGAGAACTAGGC TGG (reversed) Intergenic
No off target data available for this crispr