ID: 1051517741

View in Genome Browser
Species Human (GRCh38)
Location 9:17949632-17949654
Sequence GTTTCTGTCTTATTGCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051517737_1051517741 23 Left 1051517737 9:17949586-17949608 CCAAGCCAGACCAGCCTAGTTCT No data
Right 1051517741 9:17949632-17949654 GTTTCTGTCTTATTGCTCACAGG No data
1051517738_1051517741 18 Left 1051517738 9:17949591-17949613 CCAGACCAGCCTAGTTCTCAGTG No data
Right 1051517741 9:17949632-17949654 GTTTCTGTCTTATTGCTCACAGG No data
1051517736_1051517741 26 Left 1051517736 9:17949583-17949605 CCTCCAAGCCAGACCAGCCTAGT No data
Right 1051517741 9:17949632-17949654 GTTTCTGTCTTATTGCTCACAGG No data
1051517739_1051517741 13 Left 1051517739 9:17949596-17949618 CCAGCCTAGTTCTCAGTGCTATG No data
Right 1051517741 9:17949632-17949654 GTTTCTGTCTTATTGCTCACAGG No data
1051517740_1051517741 9 Left 1051517740 9:17949600-17949622 CCTAGTTCTCAGTGCTATGAACA No data
Right 1051517741 9:17949632-17949654 GTTTCTGTCTTATTGCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051517741 Original CRISPR GTTTCTGTCTTATTGCTCAC AGG Intergenic
No off target data available for this crispr