ID: 1051517742

View in Genome Browser
Species Human (GRCh38)
Location 9:17949640-17949662
Sequence CTTATTGCTCACAGGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051517738_1051517742 26 Left 1051517738 9:17949591-17949613 CCAGACCAGCCTAGTTCTCAGTG No data
Right 1051517742 9:17949640-17949662 CTTATTGCTCACAGGCAGCATGG No data
1051517740_1051517742 17 Left 1051517740 9:17949600-17949622 CCTAGTTCTCAGTGCTATGAACA No data
Right 1051517742 9:17949640-17949662 CTTATTGCTCACAGGCAGCATGG No data
1051517739_1051517742 21 Left 1051517739 9:17949596-17949618 CCAGCCTAGTTCTCAGTGCTATG No data
Right 1051517742 9:17949640-17949662 CTTATTGCTCACAGGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051517742 Original CRISPR CTTATTGCTCACAGGCAGCA TGG Intergenic
No off target data available for this crispr