ID: 1051517742 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:17949640-17949662 |
| Sequence | CTTATTGCTCACAGGCAGCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051517738_1051517742 | 26 | Left | 1051517738 | 9:17949591-17949613 | CCAGACCAGCCTAGTTCTCAGTG | No data | ||
| Right | 1051517742 | 9:17949640-17949662 | CTTATTGCTCACAGGCAGCATGG | No data | ||||
| 1051517740_1051517742 | 17 | Left | 1051517740 | 9:17949600-17949622 | CCTAGTTCTCAGTGCTATGAACA | No data | ||
| Right | 1051517742 | 9:17949640-17949662 | CTTATTGCTCACAGGCAGCATGG | No data | ||||
| 1051517739_1051517742 | 21 | Left | 1051517739 | 9:17949596-17949618 | CCAGCCTAGTTCTCAGTGCTATG | No data | ||
| Right | 1051517742 | 9:17949640-17949662 | CTTATTGCTCACAGGCAGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051517742 | Original CRISPR | CTTATTGCTCACAGGCAGCA TGG | Intergenic | ||
| No off target data available for this crispr | |||||