ID: 1051521579

View in Genome Browser
Species Human (GRCh38)
Location 9:17995126-17995148
Sequence TGTAGCTAAAAGACATTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051521579_1051521584 23 Left 1051521579 9:17995126-17995148 CCCAGCAATGTCTTTTAGCTACA No data
Right 1051521584 9:17995172-17995194 CCTCTTCTTAACTAGGCTACAGG No data
1051521579_1051521582 16 Left 1051521579 9:17995126-17995148 CCCAGCAATGTCTTTTAGCTACA No data
Right 1051521582 9:17995165-17995187 CCATCTTCCTCTTCTTAACTAGG No data
1051521579_1051521585 24 Left 1051521579 9:17995126-17995148 CCCAGCAATGTCTTTTAGCTACA No data
Right 1051521585 9:17995173-17995195 CTCTTCTTAACTAGGCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051521579 Original CRISPR TGTAGCTAAAAGACATTGCT GGG (reversed) Intergenic
No off target data available for this crispr