ID: 1051522961

View in Genome Browser
Species Human (GRCh38)
Location 9:18011440-18011462
Sequence CACACACTCATGCCTAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051522959_1051522961 -2 Left 1051522959 9:18011419-18011441 CCTGCAAGTGGTGAAGAATGTCA No data
Right 1051522961 9:18011440-18011462 CACACACTCATGCCTAGGAGAGG No data
1051522953_1051522961 27 Left 1051522953 9:18011390-18011412 CCCAGTGGTCAGCAATGGTCTGT No data
Right 1051522961 9:18011440-18011462 CACACACTCATGCCTAGGAGAGG No data
1051522958_1051522961 -1 Left 1051522958 9:18011418-18011440 CCCTGCAAGTGGTGAAGAATGTC No data
Right 1051522961 9:18011440-18011462 CACACACTCATGCCTAGGAGAGG No data
1051522956_1051522961 1 Left 1051522956 9:18011416-18011438 CCCCCTGCAAGTGGTGAAGAATG No data
Right 1051522961 9:18011440-18011462 CACACACTCATGCCTAGGAGAGG No data
1051522954_1051522961 26 Left 1051522954 9:18011391-18011413 CCAGTGGTCAGCAATGGTCTGTT No data
Right 1051522961 9:18011440-18011462 CACACACTCATGCCTAGGAGAGG No data
1051522957_1051522961 0 Left 1051522957 9:18011417-18011439 CCCCTGCAAGTGGTGAAGAATGT No data
Right 1051522961 9:18011440-18011462 CACACACTCATGCCTAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051522961 Original CRISPR CACACACTCATGCCTAGGAG AGG Intergenic
No off target data available for this crispr