ID: 1051524101

View in Genome Browser
Species Human (GRCh38)
Location 9:18023254-18023276
Sequence AAAGCTGATACTTTGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051524101_1051524109 -7 Left 1051524101 9:18023254-18023276 CCCTCTCCCAAAGTATCAGCTTT No data
Right 1051524109 9:18023270-18023292 CAGCTTTAGTAGGTCTGGGGTGG No data
1051524101_1051524108 -10 Left 1051524101 9:18023254-18023276 CCCTCTCCCAAAGTATCAGCTTT No data
Right 1051524108 9:18023267-18023289 TATCAGCTTTAGTAGGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051524101 Original CRISPR AAAGCTGATACTTTGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr