ID: 1051524108

View in Genome Browser
Species Human (GRCh38)
Location 9:18023267-18023289
Sequence TATCAGCTTTAGTAGGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051524098_1051524108 24 Left 1051524098 9:18023220-18023242 CCTGAAGGGCTTCTTAAAACACA No data
Right 1051524108 9:18023267-18023289 TATCAGCTTTAGTAGGTCTGGGG No data
1051524101_1051524108 -10 Left 1051524101 9:18023254-18023276 CCCTCTCCCAAAGTATCAGCTTT No data
Right 1051524108 9:18023267-18023289 TATCAGCTTTAGTAGGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051524108 Original CRISPR TATCAGCTTTAGTAGGTCTG GGG Intergenic
No off target data available for this crispr