ID: 1051525223

View in Genome Browser
Species Human (GRCh38)
Location 9:18035600-18035622
Sequence AAATTGCAACCTATTTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051525219_1051525223 11 Left 1051525219 9:18035566-18035588 CCCTTCTCAATGAGGCCTGCCTT No data
Right 1051525223 9:18035600-18035622 AAATTGCAACCTATTTTCCCTGG No data
1051525222_1051525223 -8 Left 1051525222 9:18035585-18035607 CCTTAATGACATCTAAAATTGCA No data
Right 1051525223 9:18035600-18035622 AAATTGCAACCTATTTTCCCTGG No data
1051525221_1051525223 -4 Left 1051525221 9:18035581-18035603 CCTGCCTTAATGACATCTAAAAT No data
Right 1051525223 9:18035600-18035622 AAATTGCAACCTATTTTCCCTGG No data
1051525220_1051525223 10 Left 1051525220 9:18035567-18035589 CCTTCTCAATGAGGCCTGCCTTA No data
Right 1051525223 9:18035600-18035622 AAATTGCAACCTATTTTCCCTGG No data
1051525218_1051525223 12 Left 1051525218 9:18035565-18035587 CCCCTTCTCAATGAGGCCTGCCT No data
Right 1051525223 9:18035600-18035622 AAATTGCAACCTATTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051525223 Original CRISPR AAATTGCAACCTATTTTCCC TGG Intergenic
No off target data available for this crispr