ID: 1051528482

View in Genome Browser
Species Human (GRCh38)
Location 9:18074151-18074173
Sequence GGTCTGAGATGCCCACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051528479_1051528482 -5 Left 1051528479 9:18074133-18074155 CCCCTGTGTTCTGGTGCAGGTCT No data
Right 1051528482 9:18074151-18074173 GGTCTGAGATGCCCACCAGCTGG No data
1051528481_1051528482 -7 Left 1051528481 9:18074135-18074157 CCTGTGTTCTGGTGCAGGTCTGA No data
Right 1051528482 9:18074151-18074173 GGTCTGAGATGCCCACCAGCTGG No data
1051528480_1051528482 -6 Left 1051528480 9:18074134-18074156 CCCTGTGTTCTGGTGCAGGTCTG No data
Right 1051528482 9:18074151-18074173 GGTCTGAGATGCCCACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051528482 Original CRISPR GGTCTGAGATGCCCACCAGC TGG Intergenic
No off target data available for this crispr