ID: 1051531785

View in Genome Browser
Species Human (GRCh38)
Location 9:18112247-18112269
Sequence AGGTGAACTCAGATGGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051531785_1051531790 18 Left 1051531785 9:18112247-18112269 CCTTAGTCCATCTGAGTTCACCT No data
Right 1051531790 9:18112288-18112310 AGTGCCATCTGAAAGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051531785 Original CRISPR AGGTGAACTCAGATGGACTA AGG (reversed) Intergenic
No off target data available for this crispr