ID: 1051535627

View in Genome Browser
Species Human (GRCh38)
Location 9:18154281-18154303
Sequence TCGGTCAACCCATAAATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051535627_1051535631 19 Left 1051535627 9:18154281-18154303 CCCATAATTTATGGGTTGACCGA No data
Right 1051535631 9:18154323-18154345 CTGCTCCTTGTGCATCCACTGGG No data
1051535627_1051535630 18 Left 1051535627 9:18154281-18154303 CCCATAATTTATGGGTTGACCGA No data
Right 1051535630 9:18154322-18154344 TCTGCTCCTTGTGCATCCACTGG No data
1051535627_1051535632 20 Left 1051535627 9:18154281-18154303 CCCATAATTTATGGGTTGACCGA No data
Right 1051535632 9:18154324-18154346 TGCTCCTTGTGCATCCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051535627 Original CRISPR TCGGTCAACCCATAAATTAT GGG (reversed) Intergenic
No off target data available for this crispr