ID: 1051535629

View in Genome Browser
Species Human (GRCh38)
Location 9:18154300-18154322
Sequence AAGAATCATTCAGTTGAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051535629_1051535632 1 Left 1051535629 9:18154300-18154322 CCGAGTTCAACTGAATGATTCTT No data
Right 1051535632 9:18154324-18154346 TGCTCCTTGTGCATCCACTGGGG No data
1051535629_1051535634 14 Left 1051535629 9:18154300-18154322 CCGAGTTCAACTGAATGATTCTT No data
Right 1051535634 9:18154337-18154359 TCCACTGGGGCTGCACTCTTTGG No data
1051535629_1051535630 -1 Left 1051535629 9:18154300-18154322 CCGAGTTCAACTGAATGATTCTT No data
Right 1051535630 9:18154322-18154344 TCTGCTCCTTGTGCATCCACTGG No data
1051535629_1051535636 27 Left 1051535629 9:18154300-18154322 CCGAGTTCAACTGAATGATTCTT No data
Right 1051535636 9:18154350-18154372 CACTCTTTGGAGAGCTTAGCTGG No data
1051535629_1051535631 0 Left 1051535629 9:18154300-18154322 CCGAGTTCAACTGAATGATTCTT No data
Right 1051535631 9:18154323-18154345 CTGCTCCTTGTGCATCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051535629 Original CRISPR AAGAATCATTCAGTTGAACT CGG (reversed) Intergenic
No off target data available for this crispr