ID: 1051535630

View in Genome Browser
Species Human (GRCh38)
Location 9:18154322-18154344
Sequence TCTGCTCCTTGTGCATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051535628_1051535630 17 Left 1051535628 9:18154282-18154304 CCATAATTTATGGGTTGACCGAG No data
Right 1051535630 9:18154322-18154344 TCTGCTCCTTGTGCATCCACTGG No data
1051535629_1051535630 -1 Left 1051535629 9:18154300-18154322 CCGAGTTCAACTGAATGATTCTT No data
Right 1051535630 9:18154322-18154344 TCTGCTCCTTGTGCATCCACTGG No data
1051535627_1051535630 18 Left 1051535627 9:18154281-18154303 CCCATAATTTATGGGTTGACCGA No data
Right 1051535630 9:18154322-18154344 TCTGCTCCTTGTGCATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051535630 Original CRISPR TCTGCTCCTTGTGCATCCAC TGG Intergenic
No off target data available for this crispr