ID: 1051537502

View in Genome Browser
Species Human (GRCh38)
Location 9:18177158-18177180
Sequence CTAGTGTACCAAGTTTCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051537499_1051537502 -6 Left 1051537499 9:18177141-18177163 CCAGTTACCAGTGCTGGCTAGTG No data
Right 1051537502 9:18177158-18177180 CTAGTGTACCAAGTTTCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051537502 Original CRISPR CTAGTGTACCAAGTTTCTAT GGG Intergenic
No off target data available for this crispr