ID: 1051544443

View in Genome Browser
Species Human (GRCh38)
Location 9:18258624-18258646
Sequence TCCAGGACCCTCATGGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051544434_1051544443 9 Left 1051544434 9:18258592-18258614 CCTGGATCTCCACACCCACCGCC No data
Right 1051544443 9:18258624-18258646 TCCAGGACCCTCATGGCACCAGG No data
1051544437_1051544443 -6 Left 1051544437 9:18258607-18258629 CCACCGCCAGTGCCTTCTCCAGG No data
Right 1051544443 9:18258624-18258646 TCCAGGACCCTCATGGCACCAGG No data
1051544439_1051544443 -9 Left 1051544439 9:18258610-18258632 CCGCCAGTGCCTTCTCCAGGACC No data
Right 1051544443 9:18258624-18258646 TCCAGGACCCTCATGGCACCAGG No data
1051544436_1051544443 -5 Left 1051544436 9:18258606-18258628 CCCACCGCCAGTGCCTTCTCCAG No data
Right 1051544443 9:18258624-18258646 TCCAGGACCCTCATGGCACCAGG No data
1051544433_1051544443 18 Left 1051544433 9:18258583-18258605 CCTGTGTGGCCTGGATCTCCACA No data
Right 1051544443 9:18258624-18258646 TCCAGGACCCTCATGGCACCAGG No data
1051544435_1051544443 0 Left 1051544435 9:18258601-18258623 CCACACCCACCGCCAGTGCCTTC No data
Right 1051544443 9:18258624-18258646 TCCAGGACCCTCATGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051544443 Original CRISPR TCCAGGACCCTCATGGCACC AGG Intergenic
No off target data available for this crispr