ID: 1051546693

View in Genome Browser
Species Human (GRCh38)
Location 9:18283567-18283589
Sequence CTGCAAACCACAGTGGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051546690_1051546693 -9 Left 1051546690 9:18283553-18283575 CCATGATTGCACCACTGCAAACC No data
Right 1051546693 9:18283567-18283589 CTGCAAACCACAGTGGTTGAAGG No data
1051546689_1051546693 16 Left 1051546689 9:18283528-18283550 CCTGGGAAGTTGAGGCTGCAGTG 0: 522
1: 4693
2: 19564
3: 80346
4: 200378
Right 1051546693 9:18283567-18283589 CTGCAAACCACAGTGGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051546693 Original CRISPR CTGCAAACCACAGTGGTTGA AGG Intergenic
No off target data available for this crispr