ID: 1051546737

View in Genome Browser
Species Human (GRCh38)
Location 9:18283932-18283954
Sequence AAGAAGAAGAAGAAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051546735_1051546737 -2 Left 1051546735 9:18283911-18283933 CCGTCTAAAAAAAAAAAAAAGAA 0: 223
1: 6462
2: 98462
3: 80802
4: 126100
Right 1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924
1051546734_1051546737 19 Left 1051546734 9:18283890-18283912 CCTGGGCAACAGAGCAAGACTCC 0: 8345
1: 35403
2: 95445
3: 137050
4: 165011
Right 1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051546737 Original CRISPR AAGAAGAAGAAGAAGAAGGC TGG Intergenic
Too many off-targets to display for this crispr